Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

JAZF1 cDNA

JAZF1 is a nuclear protein with three C2H2-type zinc fingers, and functions as a transcriptional repressor. Chromosomal aberrations involving JAZF1 are associated with endometrial stromal tumors. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized

Product Specifications

Product Name Alternative

TIP27, ZNF802

Chromosomal Location

7p15.2-p15.1

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGACAGGCATCGCCGCCGCCTCCTTCTTCTCCAATACCTGCCGATTCGGGGGCTGCGGACTCCACTTCCCCACCCTGGCCGACCTCATCGAGCACATCGAGGACAACCACATCGATACAGATCCACGGGTTTTAGAAAAACAAGAATTACAGCAGCCAACCTATGTTGCCCTGAGTTACATAAATAGATTCATGACAGATGCTGCCCGCCGAGAGCAGGAGTCCCTAAAGAAGAAGATTCAGCCGAAGCTCTCGCTGACTCTGTCCAGCTCAGTGTCTCGAGGGAATGTGTCCACTCCCCCACGCCACAGCAGTGGAAGCCTTACTCCCCCCGTGACCCCACCCATCACCCCCTCCTCTTCATTCCGCAGCAGCACTCCGACAGGCAGCGAGTATGACGAGGAGGAGGTGGACTATGAGGAGTCGGACAGCGATGAGTCCTGGACCACAGAGAGTGCCATCAGCTCCGAAGCCATCCTCAGCTCCATGTGCATGAATGGAGGGGAAGAGAAGCCTTTTGCCTGCCCAGTTCCTGGATGTAAAAAGAGATACAAGAATGTGAATGGCATAAAGTATCACGCTAAGAATGGTCACAGAACACAGATTCGTGTCCGCAAACCATTCAAGTGTCGCTGTGGGAAGAGTTACAAGACAGCTCAGGGCCTGCGGCACCACACAATCAATTTCCATCCCCCGGTGTCGGCTGAGATTATCAGGAAGATGCAGCAATAA

Additionnal Information

JAZF1, TIP27, ZNF802, JAZF1, ATGD0371-10 µg, ATGD0371-20 µg, ATGD0371-50 µg, ATGD0371-100 µg, ATGD0371-250 µg, ATGD0371-500 µg, ATGD0371-1 mg, ATGD0371-10, ATGD0371-20, ATGD0371-50, ATGD0371-100, ATGD0371-250, ATGD0371-500, ATGD0371-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Epigenomics (Transcription & Translation)

Omim

606246

NCBI Accession Number

NP_778231.2

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_175061.3

DNA Size

732bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Hind III. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
More Discoveries

Explore Other Products

Browse additional items from our catalog

Human Transcription initiation factor TFIID subunit 1 ELISA Kit
MBS9428643-01 96 Tests

Human Transcription initiation factor TFIID subunit 1 ELISA Kit

Sign In for Pricing
View Details
Human Transcription initiation factor TFIID subunit 1 ELISA Kit
MBS9428643-02 5x 96 Tests

Human Transcription initiation factor TFIID subunit 1 ELISA Kit

Sign In for Pricing
View Details
Klrb1 Rat Pre-designed siRNA Set A
HY-RS24302 1 Set

Klrb1 Rat Pre-designed siRNA Set A

Sign In for Pricing
View Details
GATAD2B ORF Vector (Human) (pORF)
21335011 1.0 µg DNA

GATAD2B ORF Vector (Human) (pORF)

Sign In for Pricing
View Details
5-[ (Diethylamino) methyl]furan-2-carboxylic acid
JTA79581-01 100 mg

5-[ (Diethylamino) methyl]furan-2-carboxylic acid

Sign In for Pricing
View Details
5-[ (Diethylamino) methyl]furan-2-carboxylic acid
JTA79581-02 1 g

5-[ (Diethylamino) methyl]furan-2-carboxylic acid

Sign In for Pricing
View Details