Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

THEM4 cDNA

CTMP has acyl-CoA thioesterase activity towards medium and long-chain (C14 to C18) fatty acyl-CoA substrates, and probably plays an role in mitochondrial fatty acid metabolism. It plays a role in the apoptotic process, possibly via its regulation of AKT1 activity.

Product Specifications

Product Name Alternative

CTMP

Chromosomal Location

1q21

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGCTGAGGAGCTGCGCCGCGCGCCTCCGCACGCTGGGGGCTCTGTGCCGGCCGCCAGTAGGCCGGCGCCTGCCGGGAAGCGAGCCGCGACCCGAGCTGAGGTCATTTTCTTCTGAGGAAGTCATTCTTAAGGACTGTTCTGTCCCCAACCCCAGCTGGAACAAGGACCTAAGACTGCTCTTTGACCAGTTTATGAAGAAATGTGAAGATGGCTCCTGGAAACGTTTGCCTTCATATAAACGTACACCTACTGAATGGATTCAAGACTTCAAAACCCATTTTCTTGACCCAAAGCTTATGAAAGAAGAACAAATGTCACAGGCCCAGCTCTTCACCAGAAGCTTTGATGATGGCCTGGGCTTTGAATACGTGATGTTCTACAATGACATTGAGAAAAGGATGGTTTGCTTATTTCAAGGAGGCCCTTACCTGGAAGGACCACCTGGATTCATTCATGGAGGTGCCATTGCAACCATGATTGATGCTACTGTTGGTATGTGTGCAATGATGGCTGGGGGAATCGTCATGACTGCCAATCTCAACATCAATTATAAAAGACCTATCCCTCTTTGTTCTGTTGTTATGATAAATAGCCAACTTGATAAAGTTGAAGGAAGGAAATTTTTTGTTTCCTGTAATGTTCAGAGTGTTGATGAGAAGACCCTATACTCAGAGGCGACAAGCTTATTTATAAAGCTGAATCCTGCTAAAAGTCTGACATAA

Additionnal Information

THEM4, CTMP, THEM4, ATGD0368-10 µg, ATGD0368-20 µg, ATGD0368-50 µg, ATGD0368-100 µg, ATGD0368-250 µg, ATGD0368-500 µg, ATGD0368-1 mg, ATGD0368-10, ATGD0368-20, ATGD0368-50, ATGD0368-100, ATGD0368-250, ATGD0368-500, ATGD0368-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Signal Transduction

NCBI Accession Number

NP_444283.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_053055.1

DNA Size

723bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

KLB Protein Vector (Human) (pPB-C-His)
PV053913 500 ng

KLB Protein Vector (Human) (pPB-C-His)

Sign In for Pricing
View Details
MRPS18BP1 AAV Vector (Human) (CMV)
30544101 1 µg

MRPS18BP1 AAV Vector (Human) (CMV)

Sign In for Pricing
View Details
Anti-PTPN5 antibody
STJ119024 100 µl

Anti-PTPN5 antibody

Sign In for Pricing
View Details
Mouse anti-His-tag Antibody
MBS4512896-01 0.05 mL

Mouse anti-His-tag Antibody

Sign In for Pricing
View Details
Mouse anti-His-tag Antibody
MBS4512896-02 0.1 mL

Mouse anti-His-tag Antibody

Sign In for Pricing
View Details
Mouse anti-His-tag Antibody
MBS4512896-03 5x 0.1 mL

Mouse anti-His-tag Antibody

Sign In for Pricing
View Details