Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CEBPE cDNA

CEBPE is a bZIP transcription factor which can bind as a homodimer to certain DNA regulatory regions. It can also form heterodimers with the related protein CEBP-delta. Multiple variants of this gene have been described, but the full-length nature of only one has been determined.

Product Specifications

Product Name Alternative

C/EBP-epsilon, CRP1, CCAAT enhancer binding protein epsilon, CEBP epsilon

Chromosomal Location

14q11.2

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGTCCCACGGGACCTACTACGAGTGTGAGCCCCGGGGTGGCCAGCAGCCACTCGAGTTCTCAGGGGGCCGAGCTGGGCCCGGGGAGCTAGGGGACATGTGTGAGCATGAGGCCTCCATTGACCTCTCCGCCTACATCGAGTCTGGGGAAGAGCAGCTTCTCTCCGATCTCTTTGCCGTGAAGCCAGCGCCTGAGGCCAGAGGCCTCAAGGGCCCCGGAACCCCTGCCTTCCCCCACTACTTGCCGCCTGACCCTCGGCCCTTTGCCTACCCTCCACATACCTTCGGCCCAGACAGGAAGGCGCTGGGGCCTGGCATCTACAGCAGCCCAGGGAGCTACGACCCCAGGGCTGTGGCGGTGAAGGAGGAGCCCCGGGGGCCAGAGGGCAGCCGAGCTGCCAGCCGAGGCAGCTACAATCCCCTGCAGTACCAAGTGGCACACTGTGGGCAGACAGCCATGCACCTGCCCCCAACTCTGGCAGCACCCGGCCAGCCTCTGCGCGTTCTCAAGGCCCCTTTGGCCACTGCCGCACCCCCCTGCAGTCCCCTCCTGAAGGCGCCCTCCCCGGCTGGCCCCTTACACAAGGGCAAGAAGGCAGTGAACAAAGATAGCCTTGAGTACCGGCTGAGGCGGGAGCGCAACAACATCGCCGTGCGCAAGAGCCGAGACAAGGCCAAGAGGCGCATTCTGGAGACGCAGCAGAAGGTGCTGGAGTACATGGCAGAGAACGAGCGCCTCCGCAGCCGCGTGGAGCAGCTCACCCAGGAGCTAGACACCCTCCGCAACCTCTTCCGCCAGATTCCTGAGGCGGCCAACCTCATCAAGGGCGTGGGGGGTTGCAGCTGA

Additionnal Information

CEBPE, C/EBP-epsilon, CRP1, CEBPE, ATGD0366-10 µg, ATGD0366-20 µg, ATGD0366-50 µg, ATGD0366-100 µg, ATGD0366-250 µg, ATGD0366-500 µg, ATGD0366-1 mg, ATGD0366-10, ATGD0366-20, ATGD0366-50, ATGD0366-100, ATGD0366-250, ATGD0366-500, ATGD0366-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Epigenetics and Nuclear Signaling

Omim

600749

NCBI Accession Number

NP_001796.2

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_001805.3

DNA Size

846bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Hind III. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

500ml Amber Color Round HDPE Storage Bottle, Wide Mouth, Sterile, 5/pk, 50/cs
CS0063-341301 1 Each

500ml Amber Color Round HDPE Storage Bottle, Wide Mouth, Sterile, 5/pk, 50/cs

Sign In for Pricing
View Details
SRSF3 Rabbit Polyclonal Antibody (HRP)
orb2082539 100 µL

SRSF3 Rabbit Polyclonal Antibody (HRP)

Sign In for Pricing
View Details
PMM1 Antibody
A31477-100UL 100 µL

PMM1 Antibody

Sign In for Pricing
View Details
FOXK2 Antibody
GWB-36C90E 0.1 mg

FOXK2 Antibody

Sign In for Pricing
View Details
SMARCc1 Protein Vector (Human) (pPM-C-HA)
44414021 500 ng

SMARCc1 Protein Vector (Human) (pPM-C-HA)

Sign In for Pricing
View Details
SARS-CoV-2 (2019-nCoV) Methyltransferase / ME-his Recombinant Protein
PO54520E1 100 µg

SARS-CoV-2 (2019-nCoV) Methyltransferase / ME-his Recombinant Protein

Sign In for Pricing
View Details