Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

SSX1 cDNA

SSX1 belongs to the family of highly homologous synovial sarcoma X (SSX) breakpoint proteins. These proteins may function as transcriptional repressors. This gene, and also the SSX2 and SSX4 family members, have been involved in t (X;18) (p11. 2; q11. 2) translocations that are characteristically found in all synovial sarcomas. This translocation results in the fusion of the synovial sarcoma translocation gene on chromosome 18 to one of the SSX genes on chromosome X. The encoded hybrid proteins are likely responsible for transforming activity. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome X.

Product Specifications

Product Name Alternative

CT5.1, SSRC

Chromosomal Location

Xp11.23

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGAACGGAGACGACACCTTTGCAAAGAGACCCAGGGATGATGCTAAAGCATCAGAGAAGAGAAGCAAGGCCTTTGATGATATTGCCACATACTTCTCTAAGAAAGAGTGGAAAAAGATGAAATACTCGGAGAAAATCAGCTATGTGTATATGAAGAGAAACTATAAGGCCATGACTAAACTAGGTTTCAAAGTCACCCTCCCACCTTTCATGTGTAATAAACAGGCCACAGACTTCCAGGGGAATGATTTTGATAATGACCATAACCGCAGGATTCAGGTTGAACATCCTCAGATGACTTTCGGCAGGCTCCACAGAATCATCCCGAAGATCATGCCCAAGAAGCCAGCAGAGGACGAAAATGATTCGAAGGGAGTGTCAGAAGCATCTGGCCCACAAAACGATGGGAAACAACTGCACCCCCCAGGAAAAGCAAATATTTCTGAGAAGATTAATAAGAGATCTGGACCCAAAAGGGGGAAACATGCCTGGACCCACAGACTGCGTGAGAGAAAGCAGCTGGTGATTTATGAAGAGATCAGTGACCCTGAGGAAGATGACGAGTAA

Additionnal Information

SSX1, CT5.1, SSRC, SSX1, ATGD0343-10 µg, ATGD0343-20 µg, ATGD0343-50 µg, ATGD0343-100 µg, ATGD0343-250 µg, ATGD0343-500 µg, ATGD0343-1 mg, ATGD0343-10, ATGD0343-20, ATGD0343-50, ATGD0343-100, ATGD0343-250, ATGD0343-500, ATGD0343-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Epigenomics (Transcription & Translation)

Omim

312820

NCBI Accession Number

NP_005626.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_005635.3

DNA Size

567bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
More Discoveries

Explore Other Products

Browse additional items from our catalog

RAB6A Antibody, HRP conjugated
A32690-50UG 50 µg

RAB6A Antibody, HRP conjugated

Sign In for Pricing
View Details
Recombinant Human DDX1 Protein, N-His
HP260012-01 50 µg

Recombinant Human DDX1 Protein, N-His

Sign In for Pricing
View Details
Recombinant Human DDX1 Protein, N-His
HP260012-02 100 µg

Recombinant Human DDX1 Protein, N-His

Sign In for Pricing
View Details
Recombinant Human DDX1 Protein, N-His
HP260012-03 1 mg

Recombinant Human DDX1 Protein, N-His

Sign In for Pricing
View Details
Human IgG3, lambda Isotype Control Antibody
E55A06912 100 µg

Human IgG3, lambda Isotype Control Antibody

Sign In for Pricing
View Details
Recombinant Anabaena variabilis NAD (P)H-quinone oxidoreductase subunit K (ndhK)
MBS1350707-01 0.02 mg (E-Coli)

Recombinant Anabaena variabilis NAD (P)H-quinone oxidoreductase subunit K (ndhK)

Sign In for Pricing
View Details