Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

RBPMS cDNA

RBPMS encodes a member of the RNA recognition motif family of RNA-binding proteins. The RNA recognition motif consists of two short stretches of conserved sequence, as well as a few highly conserved hydrophobic residues. The encoded protein has a single, putative RNA recognition motif in its N-terminus. Alternative splicing results in multiple transcript variants encoding different isoforms.

Product Specifications

Product Name Alternative

HERMES

Chromosomal Location

8p12

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGAACAACGGCGGCAAAGCCGAGAAGGAGAACACCCCGAGCGAGGCCAACCTTCAGGAGGAGGAGGTCCGGACCCTATTTGTCAGTGGCCTTCCTCTGGATATCAAACCTCGGGAGCTCTATCTGCTTTTCAGACCATTTAAGGGCTATGAGGGTTCTCTTATAAAGCTCACATCTAAACAGCCTGTAGGTTTTGTCAGTTTTGACAGTCGCTCAGAAGCAGAGGCTGCAAAGAATGCTTTGAATGGCATCCGCTTCGATCCTGAAATTCCGCAAACACTACGACTAGAGTTTGCTAAGGCAAACACGAAGATGGCCAAGAACAAACTCGTAGGGACTCCAAACCCCAGTACTCCTCTGCCCAACACTGTACCTCAGTTCATTGCCAGAGAGCCATATGAGCTCACAGTGCCTGCACTTTACCCCAGTAGCCCTGAAGTGTGGGCCCCGTACCCTCTGTACCCAGCGGAGTTAGCGCCTGCTCTACCTCCTCCTGCTTTCACCTATCCCGCTTCACTGCATGCCCAGATGCGCTGGCTCCCTCCCTCCGAGGCTACTTCTCAGGGCTGGAAGTCCCGTCAGTTCTGCTGA

Additionnal Information

RBPMS, HERMES, RBPMS, ATGD0338-10 µg, ATGD0338-20 µg, ATGD0338-50 µg, ATGD0338-100 µg, ATGD0338-250 µg, ATGD0338-500 µg, ATGD0338-1 mg, ATGD0338-10, ATGD0338-20, ATGD0338-50, ATGD0338-100, ATGD0338-250, ATGD0338-500, ATGD0338-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Epigenetics and Nuclear Signaling

Omim

601558

NCBI Accession Number

NP_001008710.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_001008710.2

DNA Size

591bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
More Discoveries

Explore Other Products

Browse additional items from our catalog

Human Myozenin 2 (MYOZ2) (NM_016599) AAV Particle
RC205616A1V 250 µL

Human Myozenin 2 (MYOZ2) (NM_016599) AAV Particle

Sign In for Pricing
View Details
Exonuclease III
NEB M0206S 5000 Units

Exonuclease III

Sign In for Pricing
View Details
Human CCDC23 knockdown cell line
ABC-KD2520 1 Vial

Human CCDC23 knockdown cell line

Sign In for Pricing
View Details
Ubox5 (NM_080562) Mouse Tagged Lenti ORF Clone
MR208613L3 10 µg

Ubox5 (NM_080562) Mouse Tagged Lenti ORF Clone

Sign In for Pricing
View Details
HSPA1L Recombinant Protein
OPCD04017-10UG 10 µg

HSPA1L Recombinant Protein

Sign In for Pricing
View Details
Human KRT6A / Keratin, type II cytoskeletal 6A Recombinant Protein
R10099h 1 Each

Human KRT6A / Keratin, type II cytoskeletal 6A Recombinant Protein

Sign In for Pricing
View Details