Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

PGPEP1 cDNA

PGPEP1 (pyroglutamyl peptidase I) catalyzes the hydrolysis of N-terminal pyroglutamyl residues from oligopeptides and proteins.

Product Specifications

Product Name Alternative

PAP-I, Pcp, PGP, PGP-I, PGPI, Pyroglutamyl-peptidase 1

Chromosomal Location

19p13.11

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGGAGCAGCCGAGGAAGGCGGTGGTAGTGACGGGATTTGGCCCTTTTGGGGAACACACCGTGAACGCCAGTTGGATTGCAGTTCAGGAGCTAGAAAAGCTAGGCCTTGGCGACAGCGTGGACCTGCATGTGTACGAGATTCCGGTTGAGTACCAAACAGTCCAGAGACTCATCCCCGCCCTGTGGGAGAAGCACAGTCCACAGCTGGTGGTGCATGTGGGGGTGTCAGGCATGGCGACCACAGTCACACTGGAGAAATGTGGACACAACAAGGGCTACAAGGGGCTGGACAACTGCCGCTTTTGCCCCGGCTCCCAGTGCTGCGTGGAGGACGGGCCTGAAAGCATTGACTCCATCATCGACATGGATGCTGTGTGCAAGCGAGTCACCACGTTGGGCCTGGATGTGTCGGTGACCATCTCGCAGGATGCCGGCAGATATCTCTGCGACTTTACCTACTACACCTCTTTGTACCAGAGTCACGGTCGATCAGCCTTCGTCCACGTGCCCCCACTGGGGAAGCCGTACAACGCGGACCAGCTGGGCAGGGCACTGAGAGCCATCATTGAGGAGATGTTGGACCTCCTGGAGCAGTCAGAGGGCAAAATCAACTATTGCCACAAACACTGA

Additionnal Information

Pyroglutamyl-peptidase 1, Pyroglutamyl peptidase1, Pyroglutamyl peptidase 1, PGP-I, PGPI, PGPEP-1, PGPEP1, PGPEP 1, PGP I, PGP, PCP, PAP-I, PAPI, ATGD0329-10 µg, ATGD0329-20 µg, ATGD0329-50 µg, ATGD0329-100 µg, ATGD0329-250 µg, ATGD0329-500 µg, ATGD0329-1 mg, ATGD0329-010, ATGD0329-020, ATGD0329-050, ATGD0329-100, ATGD0329-250, ATGD0329-500, ATGD0329-01M

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Enzymes & Proteases

Omim

610694

NCBI Accession Number

NP_060182.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_017712.3

DNA Size

630bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

PHF13 Antibody - N-terminal region
ARP51229_P050-25UL 25 µL

PHF13 Antibody - N-terminal region

Sign In for Pricing
View Details
GTF3C6 Protein Lysate (Rat) with C-HA Tag
22814036 100 µg

GTF3C6 Protein Lysate (Rat) with C-HA Tag

Sign In for Pricing
View Details
Recombinant Mouse IFNG/IFN-gamma Protein, C-Fc
AP96122 50 µg

Recombinant Mouse IFNG/IFN-gamma Protein, C-Fc

Sign In for Pricing
View Details
UBE2L3 Rabbit Polyclonal Antibody
TA344149 100 µL

UBE2L3 Rabbit Polyclonal Antibody

Sign In for Pricing
View Details
SLC7A1 Antibody
58-340 400 µL

SLC7A1 Antibody

Sign In for Pricing
View Details
Human Netrin 4 (Ntn4) ELISA Kit
MBS454774-01 48 Tests

Human Netrin 4 (Ntn4) ELISA Kit

Sign In for Pricing
View Details