Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

VPS72 cDNA

VPS72 is a shared subunit of two multi-component complexes, the histone acetyltransferase complex TRRAP/TIP60 as well as the chromatin remodeling SRCAP-containing complex. VPS72 may be responsible for binding H2AFZ, which has a role in chromosome segregation. VPS72 may also have a role in regulating long-term hematopoietic stem cell activity. Alternative splicing results in multiple transcript variants that encode different protein isoforms.

Product Specifications

Product Name Alternative

CFL1, Swc2, TCFL1, YL-1, YL1

Chromosomal Location

1q21

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGAGTTTGGCTGGGGGCCGGGCACCCCGGAAGACCGCTGGGAACCGGCTTTCTGGGCTTTTGGAGGCAGAGGAGGAAGATGAGTTCTACCAGACGACTTATGGGGGTTTCACAGAGGAATCCGGAGATGATGAGTATCAAGGGGACCAGTCAGACACAGAGGACGAAGTGGACTCTGACTTTGACATTGATGAAGGGGATGAACCATCCAGTGATGGAGAAGCAGAAGAGCCAAGAAGGAAGCGCCGAGTAGTCACCAAGGCCTATAAGGAACCTCTCAAGAGCTTAAGGCCTCGAAAGGTCAACACCCCGGCTGGTAGCTCTCAGAAGGCGCGAGAAGAGAAGGCACTACTGCCATTAGAACTACAAGATGACGGCTCTGACAGTCGGAAGTCTATGCGTCAGTCTACAGCTGAGCATACACGACAAACGTTCCTTCGGGTACAGGAGAGGCAGGGCCAGTCAAGACGGCGAAAGGGGCCCCACTGTGAGCGGCCACTAACCCAGGAGGAACTGCTCCGGGAGGCCAAGATCACAGAAGAGCTTAATTTACGGTCACTGGAGACATATGAGCGGCTCGAGGCTGATAAAAAGAAGCAGGTTCATAAGAAGCGGAAGTGCCCCGGGCCCATAATCACCTATCATTCAGTGACAGTGCCACTTGTTGGGGAGCCAGGCCCCAAGGAAGAGAACGTTGACATAGAAGGACTTGATCCTGCTCCCTCGGTGTCTGCATTGACTCCTCATGCTGGGACTGGACCCGTCAACCCCCCTGCTCGCTGCTCACGTACCTTCATCACTTTTAGTGATGATGCAACTTTCGAGGAATGGTTCCCCCAAGGGCGGCCCCCAAAAGTCCCTGTTCGTGAGGTCTGTCCAGTGACCCATCGTCCAGCCCTATACCGGGACCCTGTTACAGACATACCCTATGCCACTGCTCGAGCCTTCAAGATCATTCGTGAGGCTTACAAGAAGTACATTACTGCCCATGGACTGCCGCCCACTGCCTCAGCCCTGGGCCCCGGCCCGCCACCTCCTGAGCCCCTCCCTGGCTCTGGGCCCCGAGCCTTGCGCCAGAAAATTGTCATTAAATGA

Additionnal Information

VPS72, CFL1, Swc2, TCFL1, YL-1, YL1, VPS72, ATGD0319-10 µg, ATGD0319-20 µg, ATGD0319-50 µg, ATGD0319-100 µg, ATGD0319-250 µg, ATGD0319-500 µg, ATGD0319-1 mg, ATGD0319-10, ATGD0319-20, ATGD0319-50, ATGD0319-100, ATGD0319-250, ATGD0319-500, ATGD0319-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Epigenetics and Nuclear Signaling

Omim

600607

NCBI Accession Number

NP_005988.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_005997.2

DNA Size

1095bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Hind III. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Retinoid X Receptor alpha Recombinant Rabbit mAb
E43S46718 100 µL

Retinoid X Receptor alpha Recombinant Rabbit mAb

Sign In for Pricing
View Details
Olr1456 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7311804 1.0 µg DNA

Olr1456 sgRNA CRISPR Lentivector (Rat) (Target 3)

Sign In for Pricing
View Details
D6Ertd527e (NM_001167937) Mouse Tagged ORF Clone
MG214919 10 µg

D6Ertd527e (NM_001167937) Mouse Tagged ORF Clone

Sign In for Pricing
View Details
Olr772 Protein Vector (Rat) (pPB-C-His)
PV291086 500 ng

Olr772 Protein Vector (Rat) (pPB-C-His)

Sign In for Pricing
View Details
FIP1L1 siRNA (Rat)
MBS8239395-01 15 nmol

FIP1L1 siRNA (Rat)

Sign In for Pricing
View Details
FIP1L1 siRNA (Rat)
MBS8239395-02 30 nmol

FIP1L1 siRNA (Rat)

Sign In for Pricing
View Details