Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

HES2 cDNA

HES2 is a member of the HES family and contains one basic helix-loop-helix (bHLH) domain and one orange domain. The HES family members form a complex with TLE, the mammalian homologue of Groucho, and this interaction is mediated by the carboxy terminal WRPW motif of the HES proteins. Activation of Notch signaling pathway leads to activation of HES family genes through the interaction between Notch intracellular domain and RBPSuH (CSL) . HES2 is expressed in a variety of adult and embryonic tissue.

Product Specifications

Product Name Alternative

BHLHb40

Chromosomal Location

1p36.31

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGGGGCTGCCTCGCCGGGCAGGGGACGCGGCGGAGCTGCGCAAGAGCCTGAAGCCGCTGCTGGAGAAGCGCCGGCGCGCGCGCATCAACCAGAGCCTGAGCCAGCTTAAGGGGCTCATCCTGCCGCTGCTGGGCCGGGAGAACTCCAACTGCTCGAAGCTAGAGAAGGCAGACGTCCTGGAAATGACCGTGCGCTTCCTGCAGGAGCTGCCTGCGTCCTCATGGCCCACGGCAGCGCCCCTGCCTTGCGACAGCTACCGCGAGGGCTACAGCGCCTGTGTGGCGCGCCTGGCCCGCGTGCTGCCCGCCTGCCGTGTCCTGGAGCCCGCCGTGAGCGCGCGCCTGCTGGAGCACCTGTGGCGGAGAGCGGCCAGCGCCACCCTGGACGGCGGGCGCGCTGGGGATTCCAGTGGCCCGTCTGCCCCCGCCCCAGCGCCCGCGTCTGCCCCAGAGCCCGCATCCGCTCCGGTGCCCTCGCCGCCCTCGCCTCCCTGCGGCCCTGGCCTCTGGCGGCCGTGGTAG

Additionnal Information

HES2, bHLHb40, HES2, ATGD0318-10 µg, ATGD0318-20 µg, ATGD0318-50 µg, ATGD0318-100 µg, ATGD0318-250 µg, ATGD0318-500 µg, ATGD0318-1 mg, ATGD0318-10, ATGD0318-20, ATGD0318-50, ATGD0318-100, ATGD0318-250, ATGD0318-500, ATGD0318-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Epigenomics (Transcription & Translation)

Omim

609970

NCBI Accession Number

NP_061962.2

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_019089.4

DNA Size

522bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Mouse Monoclonal HLA A Antibody (SPM417) [PE]
NBP3-11399PE 0.1 mL

Mouse Monoclonal HLA A Antibody (SPM417) [PE]

Sign In for Pricing
View Details
STK25-set siRNA/shRNA/RNAi Lentivector (Human)
45738091 4x 500 ng

STK25-set siRNA/shRNA/RNAi Lentivector (Human)

Sign In for Pricing
View Details
Canine Creatine kinase M-type (CKM) ELISA Kit
AE61423DO-01 48 Tests

Canine Creatine kinase M-type (CKM) ELISA Kit

Sign In for Pricing
View Details
Canine Creatine kinase M-type (CKM) ELISA Kit
AE61423DO-02 96 Tests

Canine Creatine kinase M-type (CKM) ELISA Kit

Sign In for Pricing
View Details
Anti-SEC13L1/SEC13 Antibody Picoband®, Carrier-free
A04346-1-carrier-free 100 µg/Vial

Anti-SEC13L1/SEC13 Antibody Picoband®, Carrier-free

Sign In for Pricing
View Details
Phospho-NMDAR2A  (Tyr1246)  Antibody
ABF3675 100 µg

Phospho-NMDAR2A (Tyr1246) Antibody

Sign In for Pricing
View Details