Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

HES2 cDNA

HES2 is a member of the HES family and contains one basic helix-loop-helix (bHLH) domain and one orange domain. The HES family members form a complex with TLE, the mammalian homologue of Groucho, and this interaction is mediated by the carboxy terminal WRPW motif of the HES proteins. Activation of Notch signaling pathway leads to activation of HES family genes through the interaction between Notch intracellular domain and RBPSuH (CSL) . HES2 is expressed in a variety of adult and embryonic tissue.

Product Specifications

Product Name Alternative

BHLHb40

Chromosomal Location

1p36.31

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGGGGCTGCCTCGCCGGGCAGGGGACGCGGCGGAGCTGCGCAAGAGCCTGAAGCCGCTGCTGGAGAAGCGCCGGCGCGCGCGCATCAACCAGAGCCTGAGCCAGCTTAAGGGGCTCATCCTGCCGCTGCTGGGCCGGGAGAACTCCAACTGCTCGAAGCTAGAGAAGGCAGACGTCCTGGAAATGACCGTGCGCTTCCTGCAGGAGCTGCCTGCGTCCTCATGGCCCACGGCAGCGCCCCTGCCTTGCGACAGCTACCGCGAGGGCTACAGCGCCTGTGTGGCGCGCCTGGCCCGCGTGCTGCCCGCCTGCCGTGTCCTGGAGCCCGCCGTGAGCGCGCGCCTGCTGGAGCACCTGTGGCGGAGAGCGGCCAGCGCCACCCTGGACGGCGGGCGCGCTGGGGATTCCAGTGGCCCGTCTGCCCCCGCCCCAGCGCCCGCGTCTGCCCCAGAGCCCGCATCCGCTCCGGTGCCCTCGCCGCCCTCGCCTCCCTGCGGCCCTGGCCTCTGGCGGCCGTGGTAG

Additionnal Information

HES2, bHLHb40, HES2, ATGD0318-10 µg, ATGD0318-20 µg, ATGD0318-50 µg, ATGD0318-100 µg, ATGD0318-250 µg, ATGD0318-500 µg, ATGD0318-1 mg, ATGD0318-10, ATGD0318-20, ATGD0318-50, ATGD0318-100, ATGD0318-250, ATGD0318-500, ATGD0318-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Epigenomics (Transcription & Translation)

Omim

609970

NCBI Accession Number

NP_061962.2

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_019089.4

DNA Size

522bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

LOC679462 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV643702 1.0 µg DNA

LOC679462 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

Sign In for Pricing
View Details
ANT-1 Rabbit Polyclonal Antibody (APC)
orb1008169 100 µL

ANT-1 Rabbit Polyclonal Antibody (APC)

Sign In for Pricing
View Details
Recombinant Shigella Sonnei mug Protein (aa 1-168)
VAng-Lsx09907-50gEcoli 50 µg (E. coli)

Recombinant Shigella Sonnei mug Protein (aa 1-168)

Sign In for Pricing
View Details
Mouse Ecm1 (NM_007899) AAV Particle
MR222722A1V 250 µL

Mouse Ecm1 (NM_007899) AAV Particle

Sign In for Pricing
View Details
THAP2 Antibody
orb2675971-01 50 µL

THAP2 Antibody

Sign In for Pricing
View Details
THAP2 Antibody
orb2675971-02 100 µL

THAP2 Antibody

Sign In for Pricing
View Details