Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

HES6 cDNA

HES6 encodes a member of a subfamily of basic helix-loop-helix transcription repressors that have homology to the Drosophila enhancer of split genes. Members of this gene family regulate cell differentiation in numerous cell types. HES6 functions as a cofactor, interacting with other transcription factors through a tetrapeptide domain in its C-terminus. Alternatively spliced transcript variants encoding different isoforms have been described.

Product Specifications

Product Name Alternative

BHLHb41, bHLHc23, C-HAIRY1, HES-6

Chromosomal Location

2q37.3

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGGCGCCACCCGCGGCGCCTGGCCGGGACCGTGTGGGCCGTGAGGATGAGGACGGCTGGGAGACGCGAGGGGACCGCAAGGCCCGGAAGCCCCTGGTGGAGAAGAAGCGGCGCGCGCGGATCAACGAGAGCCTGCAGGAGCTGCGGCTGCTGCTGGCGGGCGCCGAGGTGCAGGCCAAGCTGGAGAACGCCGAAGTGCTGGAGCTGACGGTGCGGCGGGTCCAGGGTGTGCTGCGGGGCCGGGCGCGCGAGCGCGAGCAGCTGCAGGCGGAAGCGAGCGAGCGCTTCGCTGCCGGCTACATCCAGTGCATGCACGAGGTGCACACGTTCGTGTCCACGTGCCAGGCCATCGACGCTACCGTCGCTGCCGAGCTCCTGAACCATCTGCTCGAGTCCATGCCGCTGCGTGAGGGCAGCAGCTTCCAGGATCTGCTGGGGGACGCCCTGGCGGGGCCACCTAGAGCCCCTGGACGGAGTGGCTGGCCTGCGGGGGGCGCTCCGGGATCCCCAATACCCAGCCCCCCGGGTCCTGGGGACGACCTGTGCTCCGACCTGGAGGAGGCCCCTGAGGCTGAACTGAGTCAGGCTCCTGCTGAGGGGCCCGACTTGGTGCCCGCAGCCCTGGGCAGCCTGACCACAGCCCAAATTGCCCGGAGTGTCTGGAGGCCTTGGTGA

Additionnal Information

HES6, bHLHb41, bHLHc23, C-HAIRY1, HES-6, HES6, ATGD0317-10 µg, ATGD0317-20 µg, ATGD0317-50 µg, ATGD0317-100 µg, ATGD0317-250 µg, ATGD0317-500 µg, ATGD0317-1 mg, ATGD0317-10, ATGD0317-20, ATGD0317-50, ATGD0317-100, ATGD0317-250, ATGD0317-500, ATGD0317-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Epigenetics and Nuclear Signaling

Omim

610331

NCBI Accession Number

NP_061115.2

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_018645.5

DNA Size

675bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted Nde I to Hind III. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
More Discoveries

Explore Other Products

Browse additional items from our catalog

Piclozotan (anhydrous)
MBS5778097 Inquire

Piclozotan (anhydrous)

Sign In for Pricing
View Details
Recombinant Brucella Canis rplL Protein (aa 1-124)
VAng-Lsx5421-1mgEcoli 1 mg (E. coli)

Recombinant Brucella Canis rplL Protein (aa 1-124)

Sign In for Pricing
View Details
GNAZ Protein Vector (Human) (pPM-C-HA)
22309023 500 ng

GNAZ Protein Vector (Human) (pPM-C-HA)

Sign In for Pricing
View Details
Recombinant Human ASL Protein, N-His
E55P5092 50 µg

Recombinant Human ASL Protein, N-His

Sign In for Pricing
View Details
Itgb2 (NM_001037780) Rat Tagged Lenti ORF Clone
RR200890L3 10 µg

Itgb2 (NM_001037780) Rat Tagged Lenti ORF Clone

Sign In for Pricing
View Details
Hyaluronidase, Ovine, 1500U/mg discontinued
H7981-05A-01 1500 U

Hyaluronidase, Ovine, 1500U/mg discontinued

Sign In for Pricing
View Details