Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

LGALS13 cDNA

LGALS13 has lysophospholipase activity that act on biological membranes to regulate the multifunctional lysophospholipids. It is composed of two identical subunits which are held together by disulfide bonds. LGALS13 has structural similarity to several members of the beta-galactoside-binding S-type lectin family.

Product Specifications

Product Name Alternative

GAL13, PLAC8, PP13

Chromosomal Location

19q13.1

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGTCTTCTTTACCCGTGCCATACAAACTGCCTGTGTCTTTGTCTGTTGGTTCCTGCGTGATAATCAAAGGGACACCAATCCACTCTTTTATCAATGACCCACAGCTGCAGGTGGATTTCTACACTGACATGGATGAGGATTCAGATATTGCCTTCCGTTTCCGAGTGCACTTTGGCAATCATGTGGTCATGAACAGGCGTGAGTTTGGGATATGGATGTTGGAGGAGACAACAGACTACGTGCCCTTTGAGGATGGCAAACAATTTGAGCTGTGCATCTACGTACATTACAATGAGTATGAGATAAAGGTCAATGGCATACGCATTTACGGCTTTGTCCATCGAATCCCGCCATCATTTGTGAAGATGGTGCAAGTGTCGAGAGATATCTCCCTGACCTCAGTGTGTGTCTGCAATTGA

Additionnal Information

LGALS13, GAL13, PLAC8, PP13, LGALS13, ATGD0314-10 µg, ATGD0314-20 µg, ATGD0314-50 µg, ATGD0314-100 µg, ATGD0314-250 µg, ATGD0314-500 µg, ATGD0314-1 mg, ATGD0314-10, ATGD0314-20, ATGD0314-50, ATGD0314-100, ATGD0314-250, ATGD0314-500, ATGD0314-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Metabolism

Omim

608717

NCBI Accession Number

NP_037400.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_013268.2

DNA Size

420bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

CPNE2 Rabbit Polyclonal Antibody (AP)
orb939561 100 µL

CPNE2 Rabbit Polyclonal Antibody (AP)

Sign In for Pricing
View Details
C3orf39 Recombinant Protein Antigen
NBP2-34067PEP 0.1 mL

C3orf39 Recombinant Protein Antigen

Sign In for Pricing
View Details
NLRC5 Rabbit Polyclonal Antibody (RBITC)
orb1075363 100 µL

NLRC5 Rabbit Polyclonal Antibody (RBITC)

Sign In for Pricing
View Details
Rabbit Monoclonal Kynureninase Antibody (004) [CoraFluor 1]
NBP2-90525CL1 0.1 mL

Rabbit Monoclonal Kynureninase Antibody (004) [CoraFluor 1]

Sign In for Pricing
View Details
Recombinant Human immunodeficiency virus type 1 group N Gag-Pol polyprotein (gag-pol), partial
MBS1252053 Inquire

Recombinant Human immunodeficiency virus type 1 group N Gag-Pol polyprotein (gag-pol), partial

Sign In for Pricing
View Details
Rat Candida albicans (C.albicans) ELISA Kit
MBS2608457-01 48 Well

Rat Candida albicans (C.albicans) ELISA Kit

Sign In for Pricing
View Details