Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

POLR3H cDNA

Product Specifications

Product Name Alternative

RPC22.9, RPC8

Chromosomal Location

22q13.2

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGTTCGTCCTGGTGGAAATGGTGGACACCGTCCGGATCCCCCCTTGGCAGTTTGAGAGGAAGCTCAACGACTCCATTGCCGAGGAGCTGAACAAGAAGTTGGCCAACAAGGTCGTGTACAACGTGGGACTCTGCATTTGTCTGTTTGATATCACCAAACTGGAGGATGCCTATGTATTCCCTGGGGATGGCGCATCACACACCAAAGTCCATTTTCGCTGCGTGGTGTTTCATCCATTCCTAGATGAGATTCTCATTGGGAAGATCAAAGGCTGCAGCCCAGAAGGAGTGCACGTCTCTCTAGGCTTCTTCGATGACATTCTCATCCCCCCAGAGTCACTGCAGCAGCCAGCCAAGTTCGACGAAGCGGAGCAGGTGTGGGTGTGGGAGTACGAGACGGAGGAAGGAGCACACGACCTCTACATGGACACCGGCGAGGAGATCCGCTTCCGGGTGGTGGACGAGAGCTTTGTTGACACGTCCCCCACAGGGCCCAGCTCAGCAGATGCCACCACTTCCAGTGAGGAGCTGCCAAAGAAGGAGGCTCCGTACACGCTTGTGGGATCCATCAGTGAGCCAGGCCTGGGCCTTCTCTCCTGGTGGACCAGCAACTAG

Additionnal Information

POLR3H, RPC22.9, RPC8, POLR3H, ATGD0301-10 µg, ATGD0301-20 µg, ATGD0301-50 µg, ATGD0301-100 µg, ATGD0301-250 µg, ATGD0301-500 µg, ATGD0301-1 mg, ATGD0301-10, ATGD0301-20, ATGD0301-50, ATGD0301-100, ATGD0301-250, ATGD0301-500, ATGD0301-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Epigenomics (Transcription & Translation)

NCBI Accession Number

NP_612211.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_138338.4

DNA Size

615bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted Nde I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Porcine Hepatic lipase ELISA Kit
MBS736632-01 48 Well

Porcine Hepatic lipase ELISA Kit

Sign In for Pricing
View Details
Porcine Hepatic lipase ELISA Kit
MBS736632-02 96 Well

Porcine Hepatic lipase ELISA Kit

Sign In for Pricing
View Details
Porcine Hepatic lipase ELISA Kit
MBS736632-03 5x 96 Well

Porcine Hepatic lipase ELISA Kit

Sign In for Pricing
View Details
Porcine Hepatic lipase ELISA Kit
MBS736632-04 10x 96 Well

Porcine Hepatic lipase ELISA Kit

Sign In for Pricing
View Details
Calcium fluoride
orb2939764-01 25 g

Calcium fluoride

Sign In for Pricing
View Details
Calcium fluoride
orb2939764-02 50 g

Calcium fluoride

Sign In for Pricing
View Details