Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

NDUFA6 cDNA

Product Specifications

Product Name Alternative

B14, CI-B14, LYRM6, NADHB14

Chromosomal Location

22q13.2

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGGGAAAAGACATTCGCCCGCGGTCCGCACGCGCTGCTTGCAAAGGGGTGGGGTTGTGGAGTGGATGCTTTGGCAAGATGGCGGGGAGCGGCGTCCGCCAAGCTACTTCTACCGCCAGCACCTTCGTGAAGCCCATTTTCAGTCGGGACATGAACGAGGCCAAGCGGAGGGTGCGCGAGCTCTACCGCGCCTGGTATCGGGAGGTGCCGAACACTGTGCACCAATTCCAGCTGGACATCACTGTGAAAATGGGACGGGATAAAGTCCGAGAAATGTTTATGAAGAATGCCCATGTCACAGACCCCAGGGTGGTTGATCTTCTGGTCATTAAGGGAAAGATCGAACTGGAAGAAACAATTAAAGTATGGAAGCAGCGGACACATGTTATGCGGTTCTTCCATGAAACAGAAGCGCCAAGGCCAAAGGATTTCCTATCCAAGTTCTATGTTGGCCACGATCCATGA

Additionnal Information

NDUFA6, B14, CI-B14, LYRM6, NADHB14, NDUFA6, ATGD0279-10 µg, ATGD0279-20 µg, ATGD0279-50 µg, ATGD0279-100 µg, ATGD0279-250 µg, ATGD0279-500 µg, ATGD0279-1 mg, ATGD0279-10, ATGD0279-20, ATGD0279-50, ATGD0279-100, ATGD0279-250, ATGD0279-500, ATGD0279-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Signal Transduction

Omim

602138

NCBI Accession Number

NP_002481.2

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_002490.3

DNA Size

465bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Hipk3 ORF Vector (Mouse) (pORF)
23299014 1.0 µg DNA

Hipk3 ORF Vector (Mouse) (pORF)

Sign In for Pricing
View Details
ACBD3 (Acyl-Coenzyme A Binding Domain Containing 3, GCP60, GOCAP1, GOLPH1, PAP7) (MaxLight 750)
MBS6237070-01 0.1 mL

ACBD3 (Acyl-Coenzyme A Binding Domain Containing 3, GCP60, GOCAP1, GOLPH1, PAP7) (MaxLight 750)

Sign In for Pricing
View Details
ACBD3 (Acyl-Coenzyme A Binding Domain Containing 3, GCP60, GOCAP1, GOLPH1, PAP7) (MaxLight 750)
MBS6237070-02 5x 0.1 mL

ACBD3 (Acyl-Coenzyme A Binding Domain Containing 3, GCP60, GOCAP1, GOLPH1, PAP7) (MaxLight 750)

Sign In for Pricing
View Details
Anti-hnRNP H3 Rabbit pAb
GB115182 100 μL

Anti-hnRNP H3 Rabbit pAb

Sign In for Pricing
View Details
ISG15 (1-157) Mouse Monoclonal Antibody [Clone ID: 3E5]
AM09021PU-S 50 µL

ISG15 (1-157) Mouse Monoclonal Antibody [Clone ID: 3E5]

Sign In for Pricing
View Details
Recombinant Shewanella sediminis Carbon storage regulator homolog (csrA)
MBS1076715-01 0.02 mg (E-Coli)

Recombinant Shewanella sediminis Carbon storage regulator homolog (csrA)

Sign In for Pricing
View Details