Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

NDUFA5 cDNA

NDUFA5 encodes a conserved protein that comprises the B13 subunit of complex I of the mitochondrial respiratory chain. This localizes to the inner mitochondrial membrane, where it is thought to aid in the transfer of electrons from NADH to ubiquinone. Alternative splicing results in multiple transcript variants. There are numerous pseudogenes of this gene on chromosomes 1, 3, 6, 8, 9, 11, 12, and 16.

Product Specifications

Product Name Alternative

B13, CI-13kB, CI-13KD-B, NUFM, UQOR13

Chromosomal Location

7q31.33

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGGCGGGTGTGCTGAAGAAGACCACTGGCCTTGTGGGATTGGCTGTGTGCAATACTCCTCACGAGAGGCTAAGAATATTGTACACAAAGATTCTTGATGTTCTTGAGGAAATCCCTAAAAATGCAGCATATAGAAAGTATACAGAACAGATTACAAATGAGAAGCTGGCTATGGTTAAAGCGGAACCAGATGTTAAAAAATTAGAAGACCAACTTCAAGGCGGTCAATTAGAAGAGGTGATTCTTCAGGCTGAACATGAACTAAATCTGGCAAGAAAAATGAGGGAATGGAAACTATGGGAGCCATTAGTGGAAGAGCCTCCTGCCGATCAGTGGAAATGGCCAATATAA

Additionnal Information

NDUFA5, B13, CI-13kB, CI-13KD-B, NUFM, UQOR13, NDUFA5, ATGD0277-10 µg, ATGD0277-20 µg, ATGD0277-50 µg, ATGD0277-100 µg, ATGD0277-250 µg, ATGD0277-500 µg, ATGD0277-1 mg, ATGD0277-10, ATGD0277-20, ATGD0277-50, ATGD0277-100, ATGD0277-250, ATGD0277-500, ATGD0277-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Metabolism

Omim

601677

NCBI Accession Number

NP_004991.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_005000.4

DNA Size

351bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
More Discoveries

Explore Other Products

Browse additional items from our catalog

CRIPTO, CT (Teratocarcinoma-derived Growth Factor 1, Epidermal Growth Factor-like Cripto Protein CR1, Cripto-1 Growth Factor, CRGF, TDGF1) (MaxLight 750)
MBS6470654-01 0.1 mL

CRIPTO, CT (Teratocarcinoma-derived Growth Factor 1, Epidermal Growth Factor-like Cripto Protein CR1, Cripto-1 Growth Factor, CRGF, TDGF1) (MaxLight 750)

Sign In for Pricing
View Details
CRIPTO, CT (Teratocarcinoma-derived Growth Factor 1, Epidermal Growth Factor-like Cripto Protein CR1, Cripto-1 Growth Factor, CRGF, TDGF1) (MaxLight 750)
MBS6470654-02 5x 0.1 mL

CRIPTO, CT (Teratocarcinoma-derived Growth Factor 1, Epidermal Growth Factor-like Cripto Protein CR1, Cripto-1 Growth Factor, CRGF, TDGF1) (MaxLight 750)

Sign In for Pricing
View Details
Hha Antibody
orb817044 2 mg

Hha Antibody

Sign In for Pricing
View Details
Rabbit Polyclonal ARMT1 Antibody [Janelia Fluor 525]
NBP3-18466JF525 0.1 mL

Rabbit Polyclonal ARMT1 Antibody [Janelia Fluor 525]

Sign In for Pricing
View Details
SOX2, Recombinant, Human (Transcript ion Factor SOX-2, MGC2413) discontinued
143506-01 5 µg

SOX2, Recombinant, Human (Transcript ion Factor SOX-2, MGC2413) discontinued

Sign In for Pricing
View Details
SOX2, Recombinant, Human (Transcript ion Factor SOX-2, MGC2413) discontinued
143506-02 25 µg

SOX2, Recombinant, Human (Transcript ion Factor SOX-2, MGC2413) discontinued

Sign In for Pricing
View Details