Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

NDUFAF3 cDNA

NDUFAF3 encodes a mitochondrial complex I assembly protein that interacts with complex I subunits. Mutations in this gene cause mitochondrial complex I deficiency, a fatal neonatal disorder of the oxidative phosphorylation system. Alternatively spliced transcript variants encoding different isoforms have been identified.

Product Specifications

Product Name Alternative

2P1, C3orf60, E3-3

Chromosomal Location

3p21.31

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGGCCACCGCTCTCGCGCTACGTAGCTTGTACCGAGCGCGACCCTCGCTGCGCTGTCCGCCCGTTGAGCTTCCCTGGGCCCCGCGGCGAGGGCATCGGCTCTCGCCGGCGGATGACGAGCTGTATCAGCGGACGCGCATCTCTCTGCTGCAACGCGAGGCCGCTCAGGCAATGTACATCGACAGCTACAACAGCCGCGGCTTCATGATAAACGGAAACCGCGTGCTCGGCCCCTGCGCTCTGCTCCCGCACTCGGTGGTGCAGTGGAACGTGGGATCCCACCAGGACATCACCGAAGACAGCTTTTCCCTCTTCTGGTTGCTGGAGCCCCGGATAGAGATCGTGGTGGTGGGGACTGGAGACCGGACCGAGAGGCTGCAGTCCCAGGTGCTTCAAGCCATGAGGCAGCGGGGCATTGCTGTGGAAGTGCAGGACACGCCCAATGCCTGTGCCACCTTCAACTTCCTGTGTCATGAAGGCCGAGTAACTGGAGCTGCTCTCATCCCTCCACCAGGAGGGACTTCACTTACATCTTTGGGCCAAGCTGCTCAATGA

Additionnal Information

NDUFAF3, 2P1, C3orf60, E3-3, NDUFAF3, ATGD0275-10 µg, ATGD0275-20 µg, ATGD0275-50 µg, ATGD0275-100 µg, ATGD0275-250 µg, ATGD0275-500 µg, ATGD0275-1 mg, ATGD0275-10, ATGD0275-20, ATGD0275-50, ATGD0275-100, ATGD0275-250, ATGD0275-500, ATGD0275-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Signal Transduction

Omim

612911

NCBI Accession Number

NP_951032.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_199069.1

DNA Size

555bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted Nde I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
More Discoveries

Explore Other Products

Browse additional items from our catalog

IgG Antibody
OARA05211-2MG 2 mg

IgG Antibody

Sign In for Pricing
View Details
Rabbit Polyclonal TFIIB Antibody [DyLight 650]
NBP1-49981C 0.1 mL

Rabbit Polyclonal TFIIB Antibody [DyLight 650]

Sign In for Pricing
View Details
Rat Pspn Pre-designed siRNA Set A
SI211285A 1 Each

Rat Pspn Pre-designed siRNA Set A

Sign In for Pricing
View Details
Mouse Monoclonal Phospho-Tyrosine Antibody (G104) [FITC]
NBP1-47562F 0.1 mL

Mouse Monoclonal Phospho-Tyrosine Antibody (G104) [FITC]

Sign In for Pricing
View Details
Human Interferon-induced protein with tetratricopeptide repeats 3, IFIT3 ELISA Kit
MBS2602757-01 48 Well

Human Interferon-induced protein with tetratricopeptide repeats 3, IFIT3 ELISA Kit

Sign In for Pricing
View Details
Human Interferon-induced protein with tetratricopeptide repeats 3, IFIT3 ELISA Kit
MBS2602757-02 96 Well

Human Interferon-induced protein with tetratricopeptide repeats 3, IFIT3 ELISA Kit

Sign In for Pricing
View Details