Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

EIF3K cDNA

The 700-kD eukaryotic translation initiation factor-3 (eIF3) is the largest eIF and contains at least 12 subunits, including EIF2S12. eIF3 plays an essential role in translation by binding directly to the 40S ribosomal subunit and promoting formation of the 40S preinitiation complex

Product Specifications

Product Name Alternative

ARG134, EIF3-p28, EIF3S12, HSPC029, M9, MSTP001, PLAC-24, PLAC24, PRO1474, PTD001

Chromosomal Location

19q13.2

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGGCGATGTTTGAGCAGATGAGAGCCAACGTGGGCAAGTTGCTCAAGGGTATCGACAGGTACAATCCTGAGAACCTGGCCACCCTGGAGCGCTATGTAGAGACGCAGGCCAAGGAAAATGCCTATGATCTGGAAGCCAACCTGGCTGTCCTGAAGCTGTACCAGTTCAACCCAGCCTTCTTTCAGACCACGGTCACCGCCCAGATCCTGCTGAAGGCCCTCACCAACTTGCCGCACACAGACTTCACCCTGTGCAAGTGCATGATCGACCAGGCACATCAAGAAGAACGGCCAATCCGACAGATTTTGTACCTCGGGGACCTGCTGGAGACCTGCCATTTCCAGGCCTTCTGGCAAGCCCTGGATGAAAACATGGACCTCTTGGAAGGTATAACTGGCTTTGAAGACTCTGTCCGAAAGTTTATCTGCCATGTTGTGGGTATCACTTACCAGCACATTGACCGCTGGCTGCTGGCCGAGATGCTCGGGGATCTGTCGGACAGCCAGCTAAAGGTGTGGATGAGCAAATACGGCTGGAGTGCCGACGAGTCGGGGCAGATCTTCATCTGTAGCCAAGAAGAGAGCATTAAACCCAAGAACATTGTGGAGAAGATTGACTTTGACAGTGTGTCCAGCATCATGGCCTCCTCCCAGTAA

Additionnal Information

Q9UBQ5, PTD001, PRO1474, PLAC-24, PLAC24, MSTP001, M9, HSPC029, EIF3S12, EIF3-p28, EIF3K, ARG134, ATGD0260-10 µg, ATGD0260-20 µg, ATGD0260-50 µg, ATGD0260-100 µg, ATGD0260-250 µg, ATGD0260-500 µg, ATGD0260-1 mg, ATGD0260-010, ATGD0260-020, ATGD0260-050, ATGD0260-100, ATGD0260-250, ATGD0260-500, ATGD0260-01M

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Signal Transduction

Omim

609596

NCBI Accession Number

NP_037366.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_013234.3

DNA Size

657bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
More Discoveries

Explore Other Products

Browse additional items from our catalog

Egl nine homolog 3 (HRP)
314516-01 50 µg

Egl nine homolog 3 (HRP)

Sign In for Pricing
View Details
Egl nine homolog 3 (HRP)
314516-02 100 µg

Egl nine homolog 3 (HRP)

Sign In for Pricing
View Details
Cyclin D1 (MaxLight 405)
MBS6193631-01 0.1 mL

Cyclin D1 (MaxLight 405)

Sign In for Pricing
View Details
Cyclin D1 (MaxLight 405)
MBS6193631-02 5x 0.1 mL

Cyclin D1 (MaxLight 405)

Sign In for Pricing
View Details
LOX1 (LOX-1, hLOX-1, C-type Lectin Domain Family 8 Member A, CLEC8A, Lectin-like Oxidized LDL Receptor 1, Lectin-like oxLDL Receptor 1, Lectin-type Oxidized LDL Receptor 1, LOXIN, Oxidized Low-density Lipoprotein Receptor 1, Ox-LDL Receptor 1, OLR1, SCARE
MBS6485411-01 0.2 mL

LOX1 (LOX-1, hLOX-1, C-type Lectin Domain Family 8 Member A, CLEC8A, Lectin-like Oxidized LDL Receptor 1, Lectin-like oxLDL Receptor 1, Lectin-type Oxidized LDL Receptor 1, LOXIN, Oxidized Low-density Lipoprotein Receptor 1, Ox-LDL Receptor 1, OLR1, SCARE

Sign In for Pricing
View Details
LOX1 (LOX-1, hLOX-1, C-type Lectin Domain Family 8 Member A, CLEC8A, Lectin-like Oxidized LDL Receptor 1, Lectin-like oxLDL Receptor 1, Lectin-type Oxidized LDL Receptor 1, LOXIN, Oxidized Low-density Lipoprotein Receptor 1, Ox-LDL Receptor 1, OLR1, SCARE
MBS6485411-02 5x 0.2 mL

LOX1 (LOX-1, hLOX-1, C-type Lectin Domain Family 8 Member A, CLEC8A, Lectin-like Oxidized LDL Receptor 1, Lectin-like oxLDL Receptor 1, Lectin-type Oxidized LDL Receptor 1, LOXIN, Oxidized Low-density Lipoprotein Receptor 1, Ox-LDL Receptor 1, OLR1, SCARE

Sign In for Pricing
View Details