Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

NFYB cDNA

The protein encoded by NFYB is one subunit of a trimeric complex, forming a highly conserved transcription factor that binds with high specificity to CCAAT motifs in the promoter regions in a variety of genes. NFYB product, subunit B, forms a tight dimer with the C subunit, a prerequisite for subunit A association. The resulting trimer binds to DNA with high specificity and affinity. Subunits B and C each contain a histone-like motif. Observation of the histone nature of these subunits is supported by two types of evidence; protein sequence alignments and experiments with mutants.

Product Specifications

Product Name Alternative

CBF-A, CBF-B, HAP3, NF-YB

Chromosomal Location

12q22-q23

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGACAATGGATGGTGACAGTTCTACAACAGATGCTTCTCAACTAGGAATCTCTGCAGACTATATTGGAGGAAGTCATTATGTTATACAGCCTCATGATGATACTGAGGACAGCATGAATGATCATGAAGACACAAATGGTTCAAAAGAAAGTTTCAGAGAACAAGATATATATCTTCCAATAGCAAACGTGGCTAGGATAATGAAAAATGCCATACCTCAAACGGGAAAGATTGCAAAAGATGCCAAAGAATGTGTTCAAGAATGTGTAAGTGAGTTCATCAGTTTTATAACATCTGAAGCAAGTGAAAGGTGCCATCAAGAGAAACGGAAAACAATCAATGGAGAAGATATTCTCTTTGCTATGTCTACTTTAGGCTTTGACAGTTATGTGGAACCTCTGAAATTATACCTTCAGAAATTCAGAGAGGCTATGAAAGGAGAAAAGGGAATTGGTGGAGCAGTCACAGCTACAGATGGACTAAGTGAAGAGCTTACAGAGGAGGCATTTACTAACCAGTTACCAGCTGGCTTAATAACCACAGACGGTCAACAACAAAATGTTATGGTTTACACAACATCATATCAACAGATTTCTGGTGTTCAGCAAATTCAGTTTTCATGA

Additionnal Information

NFYB, CBF-A, CBF-B, HAP3, NF-YB, NFYB, ATGD0258-10 µg, ATGD0258-20 µg, ATGD0258-50 µg, ATGD0258-100 µg, ATGD0258-250 µg, ATGD0258-500 µg, ATGD0258-1 mg, ATGD0258-10, ATGD0258-20, ATGD0258-50, ATGD0258-100, ATGD0258-250, ATGD0258-500, ATGD0258-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Signal Transduction

Omim

189904

NCBI Accession Number

NP_006157.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_006166.3

DNA Size

624bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

CYP2C8 Polyclonal Antibody
UB-GEN-2526 100 µL

CYP2C8 Polyclonal Antibody

Sign In for Pricing
View Details
Anti-Fruit fly Neto alpha Antibody Fluoro550 Conjugated
DZ41243-Fluoro550 200 µL/Vial

Anti-Fruit fly Neto alpha Antibody Fluoro550 Conjugated

Sign In for Pricing
View Details
Rat Defensin Beta 1 (DEFb1) ELISA Kit
MBS2023378-01 24 Strip Well

Rat Defensin Beta 1 (DEFb1) ELISA Kit

Sign In for Pricing
View Details
Rat Defensin Beta 1 (DEFb1) ELISA Kit
MBS2023378-02 48 Well

Rat Defensin Beta 1 (DEFb1) ELISA Kit

Sign In for Pricing
View Details
Rat Defensin Beta 1 (DEFb1) ELISA Kit
MBS2023378-03 96 Well

Rat Defensin Beta 1 (DEFb1) ELISA Kit

Sign In for Pricing
View Details
Rat Defensin Beta 1 (DEFb1) ELISA Kit
MBS2023378-04 5x 96 Well

Rat Defensin Beta 1 (DEFb1) ELISA Kit

Sign In for Pricing
View Details