Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

UBE2K cDNA

UBE2K encoded by this gene belongs to the ubiquitin-conjugating enzyme family. UBE2K interacts with RING finger proteins, and it can ubiquitinate huntingtin, UBE2K product for Huntington's disease. Known functions for UBE2K include a role in aggregate formation of expanded polyglutamine proteins and the suppression of apoptosis in polyglutamine diseases, a role in the dislocation of newly synthesized MHC class I heavy chains from the endoplasmic reticulum, and involvement in foam cell formation. Multiple transcript variants encoding different isoforms have been identified for this gene.

Product Specifications

Product Name Alternative

Ubiquitin-conjugating enzyme E2 K isoform 1, E2-25K, HIP2, HYPG, LIG, UBC1

Chromosomal Location

4p14

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGGCCAACATCGCGGTGCAGCGAATCAAGCGGGAGTTCAAGGAGGTGCTGAAGAGCGAGGAGACGAGCAAAAATCAAATTAAAGTAGATCTTGTAGATGAGAATTTTACAGAATTAAGAGGAGAAATAGCAGGACCTCCAGACACACCATATGAAGGAGGAAGATACCAACTAGAGATAAAAATACCAGAAACATACCCATTTAATCCCCCTAAGGTCCGGTTTATCACTAAAATATGGCATCCTAATATTAGTTCCGTCACAGGGGCTATTTGTTTGGATATCCTGAAAGATCAATGGGCAGCTGCAATGACTCTCCGCACGGTATTATTGTCATTGCAAGCACTATTGGCAGCTGCAGAGCCAGATGATCCACAGGATGCTGTAGTAGCAAATCAGTACAAACAAAATCCCGAAATGTTCAAACAGACAGCTCGACTTTGGGCACATGTGTATGCTGGAGCACCAGTTTCTAGTCCAGAATACACCAAAAAAATAGAAAACCTATGTGCTATGGGCTTTGATAGGAATGCAGTAATAGTGGCCTTGTCTTCAAAATCATGGGATGTAGAGACTGCAACAGAATTGCTTCTGAGTAACTGA

Additionnal Information

Ubiquitin-conjugating enzyme E2 K isoform 1, Ubiquitin conjugating enzyme E2 K isoform 1, UBE2K, UBC1, UBC 1, LIG, HYPG, HIP2, E2-25K, E225K, E2 25K, ATGD0256-10 µg, ATGD0256-20 µg, ATGD0256-50 µg, ATGD0256-100 µg, ATGD0256-250 µg, ATGD0256-500 µg, ATGD0256-1 mg, ATGD0256-010, ATGD0256-020, ATGD0256-050, ATGD0256-100, ATGD0256-250, ATGD0256-500, ATGD0256-01M

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Ubiquitination

Omim

602846

NCBI Accession Number

NP_005330.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_005339.4

DNA Size

603bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

Mouse Tumor necrosis factor receptor superfamily member 5, CD40/TNFRSF5 ELISA Kit
MBS166098-01 48 Well

Mouse Tumor necrosis factor receptor superfamily member 5, CD40/TNFRSF5 ELISA Kit

Ask
View Details
Mouse Tumor necrosis factor receptor superfamily member 5, CD40/TNFRSF5 ELISA Kit
MBS166098-02 96 Well

Mouse Tumor necrosis factor receptor superfamily member 5, CD40/TNFRSF5 ELISA Kit

Ask
View Details
Mouse Tumor necrosis factor receptor superfamily member 5, CD40/TNFRSF5 ELISA Kit
MBS166098-03 5x 96 Well

Mouse Tumor necrosis factor receptor superfamily member 5, CD40/TNFRSF5 ELISA Kit

Ask
View Details
Mouse Tumor necrosis factor receptor superfamily member 5, CD40/TNFRSF5 ELISA Kit
MBS166098-04 10x 96 Well

Mouse Tumor necrosis factor receptor superfamily member 5, CD40/TNFRSF5 ELISA Kit

Ask
View Details
CDC42EP2 (Cdc42 Effector Protein 2, Binder of Rho GTPases 1, BORG1, CEP2) (AP)
MBS6130502-01 0.1 mL

CDC42EP2 (Cdc42 Effector Protein 2, Binder of Rho GTPases 1, BORG1, CEP2) (AP)

Ask
View Details
CDC42EP2 (Cdc42 Effector Protein 2, Binder of Rho GTPases 1, BORG1, CEP2) (AP)
MBS6130502-02 5x 0.1 mL

CDC42EP2 (Cdc42 Effector Protein 2, Binder of Rho GTPases 1, BORG1, CEP2) (AP)

Ask
View Details