Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

SNRPG cDNA

Core component of the spliceosomal U1, U2, U4 and U5 small nuclear ribonucleoproteins (snRNPs), the building blocks of the spliceosome. Thereby, plays an important role in the splicing of cellular pre-mRNAs. Most spliceosomal snRNPs contain a common set of Sm proteins SNRPB, SNRPD1, SNRPD2, SNRPD3, SNRPE, SNRPF and SNRPG that assemble in an heptameric protein ring on the Sm site of the small nuclear RNA to form the core snRNP. Appears to function in the U7 snRNP complex that is involved in histone 3-end processing.

Product Specifications

Product Name Alternative

Sm-G, SMG

Chromosomal Location

2p13.3

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGAGCAAAGCTCACCCTCCCGAGTTGAAAAAATTTATGGACAAGAAGTTATCATTGAAATTAAATGGTGGCAGACATGTCCAAGGAATATTGCGGGGATTTGATCCCTTTATGAACCTTGTGATAGATGAATGTGTGGAGATGGCGACTAGTGGACAACAGAACAATATTGGAATGGTGGTAATACGAGGAAATAGTATCATCATGTTAGAAGCCTTGGAACGAGTATAA

Additionnal Information

SNRPG, Sm-G, SMG, SNRPG, ATGD0250-10 µg, ATGD0250-20 µg, ATGD0250-50 µg, ATGD0250-100 µg, ATGD0250-250 µg, ATGD0250-500 µg, ATGD0250-1 mg, ATGD0250-10, ATGD0250-20, ATGD0250-50, ATGD0250-100, ATGD0250-250, ATGD0250-500, ATGD0250-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Epigenomics (Transcription & Translation)

Omim

603542

NCBI Accession Number

NP_003087.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_003096.2

DNA Size

231bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
More Discoveries

Explore Other Products

Browse additional items from our catalog

CREB, phosphorylated, Ser133 (cAMP Response Element Binding Protein) (MaxLight 750)
MBS6470610-01 0.1 mL

CREB, phosphorylated, Ser133 (cAMP Response Element Binding Protein) (MaxLight 750)

Sign In for Pricing
View Details
CREB, phosphorylated, Ser133 (cAMP Response Element Binding Protein) (MaxLight 750)
MBS6470610-02 5x 0.1 mL

CREB, phosphorylated, Ser133 (cAMP Response Element Binding Protein) (MaxLight 750)

Sign In for Pricing
View Details
C20ORF26 Adenovirus (Human)
14300051 1.0 mL

C20ORF26 Adenovirus (Human)

Sign In for Pricing
View Details
TMEM68 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2392708 1.0 µg DNA

TMEM68 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

Sign In for Pricing
View Details
SGTA Rabbit Polyclonal Antibody (Cy7)
orb1039057 100 µL

SGTA Rabbit Polyclonal Antibody (Cy7)

Sign In for Pricing
View Details
Recombinant human NCK2 protein
ATGP2235-010 10 µg

Recombinant human NCK2 protein

Sign In for Pricing
View Details