Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

SNRPD1 cDNA

SNRPD1 encodes a small nuclear ribonucleoprotein that belongs to the SNRNP core protein family. SNRPD1 may act as a charged protein scaffold to promote SNRNP assembly or strengthen SNRNP-SNRNP interactions through nonspecific electrostatic contacts with RNA. Two transcript variants encoding different isoforms have been found for this gene.

Product Specifications

Product Name Alternative

HsT2456, Sm-D1, SMD1, SNRPD

Chromosomal Location

18q11.2

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGAAGCTCGTGAGATTTTTGATGAAATTGAGTCATGAAACTGTAACCATTGAATTGAAGAACGGAACACAGGTCCATGGAACAATCACAGGTGTGGATGTCAGCATGAATACACATCTTAAAGCTGTGAAAATGACCCTGAAGAACAGAGAACCTGTACAGCTGGAAACGCTGAGTATTCGAGGAAATAACATTCGGTATTTTATTCTACCAGACAGTTTACCTCTGGATACACTACTTGTGGATGTTGAACCTAAGGTGAAATCTAAGAAAAGGGAAGCTGTTGCAGGAAGAGGCAGAGGAAGAGGAAGAGGAAGAGGACGTGGCCGTGGCAGAGGAAGAGGGGGTCCTAGGCGATAA

Additionnal Information

SNRPD1, HsT2456, Sm-D1, SMD1, SNRPD, SNRPD1, ATGD0248-10 µg, ATGD0248-20 µg, ATGD0248-50 µg, ATGD0248-100 µg, ATGD0248-250 µg, ATGD0248-500 µg, ATGD0248-1 mg, ATGD0248-10, ATGD0248-20, ATGD0248-50, ATGD0248-100, ATGD0248-250, ATGD0248-500, ATGD0248-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Epigenetics and Nuclear Signaling

Omim

601063

NCBI Accession Number

NP_008869.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_006938.3

DNA Size

360bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
More Discoveries

Explore Other Products

Browse additional items from our catalog

ATPAF1 (Biotin)
556012-01 50 µg

ATPAF1 (Biotin)

Sign In for Pricing
View Details
ATPAF1 (Biotin)
556012-02 100 µg

ATPAF1 (Biotin)

Sign In for Pricing
View Details
LCE4A CRISPRa sgRNA lentivector (set of three targets)(Human)
26364121 3x 1.0µg DNA

LCE4A CRISPRa sgRNA lentivector (set of three targets)(Human)

Sign In for Pricing
View Details
Agarose DNA Fragments 50-1000bp
A1005-01 25 g

Agarose DNA Fragments 50-1000bp

Sign In for Pricing
View Details
Agarose DNA Fragments 50-1000bp
A1005-02 100 g

Agarose DNA Fragments 50-1000bp

Sign In for Pricing
View Details
Agarose DNA Fragments 50-1000bp
A1005-03 250 g

Agarose DNA Fragments 50-1000bp

Sign In for Pricing
View Details