Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

PFDN4 cDNA

PFDN4 encodes a member of the prefoldin beta subunit family. The encoded protein is one of six subunits of prefoldin, a molecular chaperone complex that binds and stabilizes newly synthesized polypeptides, thereby allowing them to fold correctly. The complex, consisting of two alpha and four beta subunits, forms a double beta barrel assembly with six protruding coiled-coils.

Product Specifications

Product Name Alternative

C1, PFD4

Chromosomal Location

20q13.2

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGGCGGCCACCATGAAGAAGGCGGCTGCAGAAGATGTCAATGTTACTTTCGAAGATCAACAAAAGATAAACAAATTTGCACGGAATACAAGTAGAATCACAGAGCTGAAGGAAGAAATAGAAGTAAAAAAGAAACAACTCCAAAACCTAGAAGATGCTTGTGATGACATCATGCTTGCAGATGATGATTGCTTAATGATACCTTATCAAATTGGTGATGTCTTCATTAGCCATTCTCAAGAAGAAACGCAAGAAATGTTAGAAGAAGCAAAGAAAAATTTGCAAGAAGAAATTGACGCCTTAGAATCCAGAGTGGAATCAATTCAGCGAGTGTTAGCAGATTTGAAAGTTCAGTTGTATGCAAAATTCGGGAGCAACATAAACCTTGAAGCTGATGAAAGTTAA

Additionnal Information

PFDN4, C1, PFD4, PFDN4, ATGD0244-10 µg, ATGD0244-20 µg, ATGD0244-50 µg, ATGD0244-100 µg, ATGD0244-250 µg, ATGD0244-500 µg, ATGD0244-1 mg, ATGD0244-10, ATGD0244-20, ATGD0244-50, ATGD0244-100, ATGD0244-250, ATGD0244-500, ATGD0244-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Heat Shock Proteins

Omim

604898

NCBI Accession Number

NP_002614.2

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_002623.3

DNA Size

405bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
More Discoveries

Explore Other Products

Browse additional items from our catalog

Mouse Anti-D-DIMER antibody (V1102)
V1102 100 µg

Mouse Anti-D-DIMER antibody (V1102)

Sign In for Pricing
View Details
Lamin A/C Antibody
E51A00690 100 µL

Lamin A/C Antibody

Sign In for Pricing
View Details
NFkB p65 Antibody
252073 0.1 mg

NFkB p65 Antibody

Sign In for Pricing
View Details
Nephrin (NPHS1) Antibody
abx227052-01 20 µL

Nephrin (NPHS1) Antibody

Sign In for Pricing
View Details
Nephrin (NPHS1) Antibody
abx227052-02 50 µL

Nephrin (NPHS1) Antibody

Sign In for Pricing
View Details
Nephrin (NPHS1) Antibody
abx227052-03 100 µL

Nephrin (NPHS1) Antibody

Sign In for Pricing
View Details