Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

RGN cDNA

RGN is a highly conserved, calcium-binding protein, that is preferentially expressed in the liver and kidney. It may have an important role in calcium homeostasis. Studies in rat indicate that this protein may also play a role in aging, as it shows age-associated down-regulation. This gene is part of a gene cluster on chromosome Xp11. 3-Xp11. 23. Alternative splicing results in multiple transcript variants.

Product Specifications

Product Name Alternative

GNL, HEL-S-41, RC, SMP30

Chromosomal Location

Xp11.3

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGTCTTCCATTAAGATTGAGTGTGTTTTGCCAGAGAACTGCCGGTGTGGTGAGTCTCCAGTATGGGAGGAAGTGTCCAACTCTCTGCTCTTTGTAGACATTCCTGCAAAAAAGGTTTGCCGGTGGGATTCATTCACCAAGCAAGTACAGCGAGTGACCATGGATGCCCCAGTCAGCTCCGTGGCTCTTCGCCAGTCGGGAGGCTATGTTGCCACCATTGGAACAAAGTTCTGTGCTTTGAACTGGAAAGAACAATCAGCAGTTGTCTTGGCCACGGTGGATAACGACAAGAAAAACAATCGCTTCAATGATGGGAAGGTGGATCCCGCCGGGAGGTACTTTGCTGGCACCATGGCTGAGGAAACAGCTCCAGCAGTTCTTGAGCGGCACCAGGGGGCCCTGTACTCCCTCTTTCCTGATCACCACGTGAAAAAGTACTTTGACCAGGTGGACATTTCCAATGGTTTGGATTGGTCGCTAGACCACAAAATCTTCTATTACATTGACAGCCTGTCCTACTCCGTGGATGCCTTTGACTATGACCTGCAGACAGGACAGATCTCCAACCGCAGAAGTGTTTACAAGCTAGAAAAGGAAGAACAAATCCCAGATGGAATGTGTATTGATGCTGAGGGGAAGCTCTGGGTGGCCTGTTACAATGGAGGAAGAGTGATTCGTTTAGATCCTGTGACAGGGAAAAGACTTCAAACTGTGAAGTTGCCTGTTGATAAAACAACTTCATGCTGCTTTGGAGGGAAGAATTACTCTGAAATGTATGTGACCTGCGCCCGGGATGGGATGGACCCCGAGGGTCTTTTGAGGCAACCTGAAGCTGGTGGAATTTTCAAGATAACTGGTCTGGGGGTCAAAGGAATTGCTCCCTACTCCTATGCGGGATGA

Additionnal Information

RGN, GNL, HEL-S-41, RC, SMP30, RGN, ATGD0232-10 µg, ATGD0232-20 µg, ATGD0232-50 µg, ATGD0232-100 µg, ATGD0232-250 µg, ATGD0232-500 µg, ATGD0232-1 mg, ATGD0232-10, ATGD0232-20, ATGD0232-50, ATGD0232-100, ATGD0232-250, ATGD0232-500, ATGD0232-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Signal Transduction

Omim

300212

NCBI Accession Number

NP_690608.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_152869

DNA Size

900bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted Nde I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

GADD45GIP1 (Growth Arrest and DNA-damage-inducible Proteins-interacting Protein 1, PRG6, CRIF1, PLINP, CKBBP2, Plinp1, MRP-L59, PLINP-1, CKbetaBP2) (PE)
MBS6418047-01 0.1 mL

GADD45GIP1 (Growth Arrest and DNA-damage-inducible Proteins-interacting Protein 1, PRG6, CRIF1, PLINP, CKBBP2, Plinp1, MRP-L59, PLINP-1, CKbetaBP2) (PE)

Sign In for Pricing
View Details
GADD45GIP1 (Growth Arrest and DNA-damage-inducible Proteins-interacting Protein 1, PRG6, CRIF1, PLINP, CKBBP2, Plinp1, MRP-L59, PLINP-1, CKbetaBP2) (PE)
MBS6418047-02 5x 0.1 mL

GADD45GIP1 (Growth Arrest and DNA-damage-inducible Proteins-interacting Protein 1, PRG6, CRIF1, PLINP, CKBBP2, Plinp1, MRP-L59, PLINP-1, CKbetaBP2) (PE)

Sign In for Pricing
View Details
Odf2l (NM_001162538) Mouse Tagged Lenti ORF Clone
MR218092L4 10 µg

Odf2l (NM_001162538) Mouse Tagged Lenti ORF Clone

Sign In for Pricing
View Details
YIPF3 Protein Vector (Mouse) (pPM-C-HA)
PV248044 500 ng

YIPF3 Protein Vector (Mouse) (pPM-C-HA)

Sign In for Pricing
View Details
PRDX2, CT (Peroxiredoxin-2, Thioredoxin Peroxidase 1, Thioredoxin-dependent Peroxide Reductase 1, Thiol-specific Antioxidant Protein, TSA, PRP, Natural Killer Cell-enhancing Factor B, NKEF-B, TDPX1, NKEFB) (FITC) discontinued
P3352-12A-FITC 200 µL

PRDX2, CT (Peroxiredoxin-2, Thioredoxin Peroxidase 1, Thioredoxin-dependent Peroxide Reductase 1, Thiol-specific Antioxidant Protein, TSA, PRP, Natural Killer Cell-enhancing Factor B, NKEF-B, TDPX1, NKEFB) (FITC) discontinued

Sign In for Pricing
View Details
Ston2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4531002 1.0 µg DNA

Ston2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

Sign In for Pricing
View Details