Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

TPM3 cDNA

TPM3 encodes a member of the tropomyosin family of actin-binding proteins. Tropomyosins are dimers of coiled-coil proteins that provide stability to actin filaments and regulate access of other actin-binding proteins. Mutations in this gene result in autosomal dominant nemaline myopathy and other muscle disorders. This locus is involved in translocations with other loci, including anaplastic lymphoma receptor tyrosine kinase (ALK) and neurotrophic tyrosine kinase receptor type 1 (NTRK1), which result in the formation of fusion proteins that act as oncogenes. There are numerous pseudogenes for this gene on different chromosomes. Alternative splicing results in multiple transcript variants.

Product Specifications

Product Name Alternative

CAPM1, CFTD, HEL-189, HEL-S-82p, hscp30, NEM1, OK/SW-cl.5, TM-5, TM3, TM30, TM30 nm, TM5, TPMsk3, TRK

Chromosomal Location

1q21.2

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGGCTGGGATCACCACCATCGAGGCGGTGAAGCGCAAGATCCAGGTTCTGCAGCAGCAGGCAGATGATGCAGAGGAGCGAGCTGAGCGCCTCCAGCGAGAAGTTGAGGGAGAAAGGCGGGCCCGGGAACAGGCTGAGGCTGAGGTGGCCTCCTTGAACCGTAGGATCCAGCTGGTTGAAGAAGAGCTGGACCGTGCTCAGGAGCGCCTGGCCACTGCCCTGCAAAAGCTGGAAGAAGCTGAAAAAGCTGCTGATGAGAGTGAGAGAGGTATGAAGGTTATTGAAAACCGGGCCTTAAAAGATGAAGAAAAGATGGAACTCCAGGAAATCCAACTCAAAGAAGCTAAGCACATTGCAGAAGAGGCAGATAGGAAGTATGAAGAGGTGGCTCGTAAGTTGGTGATCATTGAAGGAGACTTGGAACGCACAGAGGAACGAGCTGAGCTGGCAGAGTCCCGTTGCCGAGAGATGGATGAGCAGATTAGACTGATGGACCAGAACCTGAAGTGTCTGAGTGCTGCTGAAGAAAAGTACTCTCAAAAAGAAGATAAATATGAGGAAGAAATCAAGATTCTTACTGATAAACTCAAGGAGGCAGAGACCCGTGCTGAGTTTGCTGAGAGATCGGTAGCCAAGCTGGAAAAGACAATTGATGACCTGGAAGATAAACTGAAATGCACCAAAGAGGAGCACCTCTGTACACAAAGGATGCTGGACCAGACCCTGCTTGACCTGAATGAGATGTAG

Additionnal Information

TPM3, CAPM1, CFTD, HEL-189, HEL-S-82p, hscp30, NEM1, OK/SW-cl.5, TM-5, TM3, TM30, TM30 nm, TM5, TPMsk3, TRK, TPM3, ATGD0231-10 µg, ATGD0231-20 µg, ATGD0231-50 µg, ATGD0231-100 µg, ATGD0231-250 µg, ATGD0231-500 µg, ATGD0231-1 mg, ATGD0231-10, ATGD0231-20, ATGD0231-50, ATGD0231-100, ATGD0231-250, ATGD0231-500, ATGD0231-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Cytoskeleton

Omim

191030

NCBI Accession Number

NP_705935.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_153649.3

DNA Size

747bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted Nde I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

MIR7976 Human MicroRNA Expression Plasmid (MI0025752)
SC402395 10 µg

MIR7976 Human MicroRNA Expression Plasmid (MI0025752)

Sign In for Pricing
View Details
3-[ (2-nitrophenyl) amino]propanoic acid
sc-275877 1 g

3-[ (2-nitrophenyl) amino]propanoic acid

Sign In for Pricing
View Details
ACES Buffer 0.2M, pH 6.5
40120287-1 100 mL

ACES Buffer 0.2M, pH 6.5

Sign In for Pricing
View Details
PDCL2 Antibody, Biotin conjugated
A62822-100UG 100 µg

PDCL2 Antibody, Biotin conjugated

Sign In for Pricing
View Details
Anti-PDCL2 Antibody Picoband® Fluoro594 Conjugated
A10894-1-Fluoro594 100 µg/Vial

Anti-PDCL2 Antibody Picoband® Fluoro594 Conjugated

Sign In for Pricing
View Details
Lentiviral mouse Igsf21 shRNA (UAS) - Lentiviral mouse Igsf21 shRNA (UAS, GFP) (100)
GTR15301812 1 Vial

Lentiviral mouse Igsf21 shRNA (UAS) - Lentiviral mouse Igsf21 shRNA (UAS, GFP) (100)

Sign In for Pricing
View Details