Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

MRTO4 cDNA

MRTO4 encodes a protein sharing a low level of sequence similarity with ribosomal protein P0. While the precise function of the encoded protein is currently unknown, it appears to be involved in mRNA turnover and ribosome assembly.

Product Specifications

Product Name Alternative

C1orf33, dJ657E11.4, MRT4

Chromosomal Location

1p36.13

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGCCCAAATCCAAGCGCGACAAGAAAGTCTCCTTAACCAAAACTGCCAAGAAAGGCTTGGAATTGAAACAAAACCTGATAGAAGAGCTTCGGAAATGTGTGGACACCTACAAGTACCTTTTCATCTTCTCTGTGGCCAACATGAGGAACAGCAAGCTGAAGGACATCCGGAACGCCTGGAAGCACAGCCGGATGTTCTTTGGCAAAAACAAGGTGATGATGGTGGCCTTGGGTCGGAGCCCATCTGATGAATACAAAGACAACCTGCACCAGGTCAGCAAAAGGTTGAGGGGTGAGGTGGGTCTCCTGTTCACCAACCGCACAAAGGAGGAGGTGAATGAGTGGTTCACGAAATACACAGAAATGGACTACGCCCGAGCTGGTAACAAAGCAGCTTTCACTGTGAGCCTGGATCCAGGGCCCCTGGAGCAGTTCCCCCACTCCATGGAGCCACAGCTCAGGCAGCTGGGCCTGCCCACCGCCCTCAAGAGAGGTGTGGTGACTCTGCTGTCTGACTACGAGGTGTGCAAGGAGGGCGATGTGCTGACCCCAGAGCAGGCTCGCGTCCTGAAGCTTTTTGGGTATGAGATGGCTGAATTCAAGGTGACCATCAAATACATGTGGGATTCACAGTCGGGAAGGTTCCAGCAGATGGGAGACGACTTGCCAGAGAGCGCATCTGAGTCCACAGAAGAGTCAGACTCAGAAGATGATGACTGA

Additionnal Information

MRTO4, C1orf33, dJ657E11.4, MRT4, MRTO4, ATGD0227-10 µg, ATGD0227-20 µg, ATGD0227-50 µg, ATGD0227-100 µg, ATGD0227-250 µg, ATGD0227-500 µg, ATGD0227-1 mg, ATGD0227-10, ATGD0227-20, ATGD0227-50, ATGD0227-100, ATGD0227-250, ATGD0227-500, ATGD0227-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Epigenomics (Transcription & Translation)

NCBI Accession Number

NP_057267.2

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_016183.3

DNA Size

720bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted Nde I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
More Discoveries

Explore Other Products

Browse additional items from our catalog

Lentiviral mouse Clca3b shRNA (UAS) - Lentiviral mouse Clca3b shRNA (UAS) plasmid
GTR15130987 1 Vial

Lentiviral mouse Clca3b shRNA (UAS) - Lentiviral mouse Clca3b shRNA (UAS) plasmid

Sign In for Pricing
View Details
MMP16 Polyclonal Antibody
29064-01 50 µL

MMP16 Polyclonal Antibody

Sign In for Pricing
View Details
MMP16 Polyclonal Antibody
29064-02 100 µL

MMP16 Polyclonal Antibody

Sign In for Pricing
View Details
Recombinant Roseiflexus sp. 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase (menD), partial
MBS1223743 Inquire

Recombinant Roseiflexus sp. 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase (menD), partial

Sign In for Pricing
View Details
RFX4 Protein Vector (Mouse) (pPM-C-HA)
38882025 500 ng

RFX4 Protein Vector (Mouse) (pPM-C-HA)

Sign In for Pricing
View Details
Collagen Alpha-1 III Chain (COL3A1) Antibody
abx171840-01 100 µL

Collagen Alpha-1 III Chain (COL3A1) Antibody

Sign In for Pricing
View Details