Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

NCALD cDNA

NCALD encodes a member of the neuronal calcium sensor (NCS) family of calcium-binding proteins. The protein contains an N-terminal myristoylation signal and four EF-hand calcium binding loops. The protein is cytosolic at resting calcium levels; however, elevated intracellular calcium levels induce a conformational change that exposes the myristoyl group, resulting in protein association with membranes and partial co-localization with the perinuclear trans-golgi network. The protein is thought to be a regulator of G protein-coupled receptor signal transduction. Several alternatively spliced variants of this gene have been determined, all of which encode the same protein; additional variants may exist but their biological validity has not been determined.

Product Specifications

Chromosomal Location

8q22.2

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGGGGAAACAGAACAGCAAGCTGCGCCCGGAGGTCATGCAGGACTTGCTGGAAAGCACAGACTTTACAGAGCATGAGATCCAGGAATGGTATAAAGGCTTCTTGAGAGACTGCCCCAGTGGACATTTGTCAATGGAAGAGTTTAAGAAAATATATGGGAACTTTTTCCCTTATGGGGATGCTTCCAAATTTGCAGAGCATGTCTTCCGCACCTTCGATGCAAATGGAGATGGGACAATAGACTTTAGAGAATTCATCATCGCCTTGAGTGTAACTTCGAGGGGGAAGCTGGAGCAGAAGCTGAAATGGGCCTTCAGCATGTACGACCTGGACGGAAATGGCTATATCAGCAAGGCAGAGATGCTAGAGATCGTGCAGGCAATCTATAAGATGGTTTCCTCTGTAATGAAAATGCCTGAAGATGAGTCAACCCCAGAGAAAAGAACAGAAAAGATCTTCCGCCAGATGGACACCAATAGAGACGGAAAACTCTCCCTGGAAGAGTTCATCCGAGGAGCCAAAAGCGACCCGTCCATTGTGCGCCTCCTGCAGTGCGACCCGAGCAGTGCCGGCCAGTTCTGA

Additionnal Information

NCALD, NCALD, ATGD0224-10 µg, ATGD0224-20 µg, ATGD0224-50 µg, ATGD0224-100 µg, ATGD0224-250 µg, ATGD0224-500 µg, ATGD0224-1 mg, ATGD0224-10, ATGD0224-20, ATGD0224-50, ATGD0224-100, ATGD0224-250, ATGD0224-500, ATGD0224-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Neuroscience

Omim

606722

NCBI Accession Number

NP_001035720.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_001040630.1

DNA Size

582bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

MAML1/Mastermind Antibody
orb18813 100 µg

MAML1/Mastermind Antibody

Sign In for Pricing
View Details
OR5AR1 (NM_001004730) Human Tagged ORF Clone Lentiviral Particle
RC222978L4V 200 µL

OR5AR1 (NM_001004730) Human Tagged ORF Clone Lentiviral Particle

Sign In for Pricing
View Details
Human RL3R2 full length protein-synthetic nanodisc
E33F100456 10 µg

Human RL3R2 full length protein-synthetic nanodisc

Sign In for Pricing
View Details
Chicken Alpha-1-Acid Glycoprotein (α1-AGP) ELISA Kit
NSL1202Ch 96 Tests

Chicken Alpha-1-Acid Glycoprotein (α1-AGP) ELISA Kit

Sign In for Pricing
View Details
PE/Cyanine7 Anti-Human CD24 Antibody
DL21791F-01 20 Tests

PE/Cyanine7 Anti-Human CD24 Antibody

Sign In for Pricing
View Details
PE/Cyanine7 Anti-Human CD24 Antibody
DL21791F-02 50 Tests

PE/Cyanine7 Anti-Human CD24 Antibody

Sign In for Pricing
View Details