Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CIB2 cDNA

The protein encoded by CIB2 is similar to that of KIP/CIB, calcineurin B, and calmodulin. The encoded protein is a calcium-binding regulatory protein that interacts with DNA-dependent protein kinase catalytic subunits (DNA-PKcs), and it is involved in photoreceptor cell maintenance. Mutations in this gene cause deafness, autosomal recessive, 48 (DFNB48), and also Usher syndrome 1J (USH1J) . Alternative splicing results in multiple transcript variants.

Product Specifications

Product Name Alternative

DFNB48, KIP2, USH1J

Chromosomal Location

15q24

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGGGGAACAAGCAGACCATCTTCACCGAAGAGCAGCTAGACAACTACCAGGACTGCACCTTCTTCAATAAGAAGGACATCCTCAAGCTGCATTCGCGATTCTATGAGCTGGCCCCCAACCTCGTCCCAATGGACTACAGGAAGAGCCCCATCGTCCACGTGCCCATGAGCCTCATCATCCAGATGCCAGAGCTCCGGGAGAATCCCTTCAAAGAAAGGATCGTGGCGGCGTTTTCCGAGGATGGTGAGGGGAACCTCACTTTCAACGACTTTGTGGACATGTTTTCCGTGCTCTGCGAGTCGGCTCCCCGAGAGCTCAAGGCAAACTATGCCTTCAAGATCTATGACTTCAACACTGACAACTTCATCTGCAAGGAGGACCTGGAGCTGACGCTGGCCCGGCTCACTAAGTCAGAGCTGGATGAGGAGGAGGTGGTGCTTGTGTGCGACAAGGTCATTGAGGAGGCTGACTTGGACGGTGACGGCAAGCTGGGCTTTGCTGACTTCGAGGACATGATTGCCAAGGCCCCTGACTTCCTCAGCACTTTCCACATCCGGATCTGA

Additionnal Information

CIB2, DFNB48, KIP2, USH1J, CIB2, ATGD0223-10 µg, ATGD0223-20 µg, ATGD0223-50 µg, ATGD0223-100 µg, ATGD0223-250 µg, ATGD0223-500 µg, ATGD0223-1 mg, ATGD0223-10, ATGD0223-20, ATGD0223-50, ATGD0223-100, ATGD0223-250, ATGD0223-500, ATGD0223-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Signal Transduction

Omim

605564

NCBI Accession Number

NP_006374.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_006383.3

DNA Size

564bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

ARHGEF2 (Rho Guanine Nucleotide Exchange Factor 2, Guanine Nucleotide Exchange Factor H1, GEF-H1, Microtubule-Regulated Rho-GEF, Proliferating Cell Nucleolar Antigen p40, ARHGEF2, KIAA0651, LFP40) discontinued
220847-01 50 µL

ARHGEF2 (Rho Guanine Nucleotide Exchange Factor 2, Guanine Nucleotide Exchange Factor H1, GEF-H1, Microtubule-Regulated Rho-GEF, Proliferating Cell Nucleolar Antigen p40, ARHGEF2, KIAA0651, LFP40) discontinued

Sign In for Pricing
View Details
ARHGEF2 (Rho Guanine Nucleotide Exchange Factor 2, Guanine Nucleotide Exchange Factor H1, GEF-H1, Microtubule-Regulated Rho-GEF, Proliferating Cell Nucleolar Antigen p40, ARHGEF2, KIAA0651, LFP40) discontinued
220847-02 100 µL

ARHGEF2 (Rho Guanine Nucleotide Exchange Factor 2, Guanine Nucleotide Exchange Factor H1, GEF-H1, Microtubule-Regulated Rho-GEF, Proliferating Cell Nucleolar Antigen p40, ARHGEF2, KIAA0651, LFP40) discontinued

Sign In for Pricing
View Details
Acetyl-Histone H4 (K16)
304336-01 50 µg

Acetyl-Histone H4 (K16)

Sign In for Pricing
View Details
Acetyl-Histone H4 (K16)
304336-02 100 µg

Acetyl-Histone H4 (K16)

Sign In for Pricing
View Details
Lentiviral mouse Ccdc12 shRNA (UAS) - Lentiviral mouse Ccdc12 shRNA (UAS, GFP) plasmid
GTR15265450 1 Vial

Lentiviral mouse Ccdc12 shRNA (UAS) - Lentiviral mouse Ccdc12 shRNA (UAS, GFP) plasmid

Sign In for Pricing
View Details
Butenachlor
orb1698005-01 25 mg

Butenachlor

Sign In for Pricing
View Details