Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

NRGN cDNA

Neurogranin (NRGN) is the human homolog of the neuron-specific rat RC3/neurogranin gene. This gene encodes a postsynaptic protein kinase substrate that binds calmodulin in the absence of calcium. The NRGN gene contains four exons and three introns. The exons 1 and 2 encode the protein and exons 3 and 4 contain untranslated sequences. It is suggested that the NRGN is a direct target for thyroid hormone in human brain, and that control of expression of this gene could underlay many of the consequences of hypothyroidism on mental states during development as well as in adult subjects.

Product Specifications

Product Name Alternative

Neurogranin, NRGN, HNG, RC3

Chromosomal Location

11q24

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGGACTGCTGCACCGAGAACGCCTGCTCCAAGCCGGACGACGACATTCTAGACATCCCGCTGGACGATCCCGGCGCCAACGCGGCCGCCGCCAAAATCCAGGCGAGTTTTCGGGGCCACATGGCGCGGAAGAAGATAAAGAGCGGAGAGCGCGGCCGGAAGGGCCCGGGCCCTGGGGGGCCTGGCGGAGCTGGGGTGGCCCGGGGAGGCGCGGGCGGCGGCCCCAGCGGAGACTAG

Additionnal Information

Neurogranin, NRGN, HNG, RC3, ATGD0219-10 µg, ATGD0219-20 µg, ATGD0219-50 µg, ATGD0219-100 µg, ATGD0219-250 µg, ATGD0219-500 µg, ATGD0219-1 mg, ATGD0219-010, ATGD0219-020, ATGD0219-050, ATGD0219-100, ATGD0219-250, ATGD0219-500, ATGD0219-01M

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Neuroscience

Omim

602350

NCBI Accession Number

NP_001119653.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_001126181.1

DNA Size

237bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

pCMV-SPORT6-Poll Plasmid
PVT43380 2 µg

pCMV-SPORT6-Poll Plasmid

Sign In for Pricing
View Details
Human Striatin-4 (STRN4) ELISA Kit
abx547800 96 Tests

Human Striatin-4 (STRN4) ELISA Kit

Sign In for Pricing
View Details
Recombinant Human FMO1 Protein, His-tagged
FMO1-240H 10 µg

Recombinant Human FMO1 Protein, His-tagged

Sign In for Pricing
View Details
Rabbit Polyclonal ITPA Antibody
NBP1-32494 100 µL

Rabbit Polyclonal ITPA Antibody

Sign In for Pricing
View Details
TBC1D22A Adenovirus (Human)
46238051 1.0 mL

TBC1D22A Adenovirus (Human)

Sign In for Pricing
View Details
Muscle Skeletal Receptor Tyrosine Kinase Antibody (MUSK Ab) Human ELISA Kit
F1456 96 Tests

Muscle Skeletal Receptor Tyrosine Kinase Antibody (MUSK Ab) Human ELISA Kit

Sign In for Pricing
View Details