Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

METTL1 cDNA

METTL1 is similar in sequence to the S. cerevisiae YDL201w gene. The gene product contains a conserved S-adenosylmethionine-binding motif and is inactivated by phosphorylation. Alternative splice variants encoding different protein isoforms have been described for this gene. A pseudogene has been identified on chromosome X.

Product Specifications

Product Name Alternative

C12orf1, TRM8, TRMT8, YDL201w

Chromosomal Location

12q13

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGGCAGCCGAGACTCGGAACGTGGCCGGAGCAGAGGCCCCACCGCCCCAGAAGCGCTACTACCGGCAACGTGCTCACTCCAACCCCATGGCGGACCACACGCTGCGCTACCCTGTGAAGCCAGAGGAGATGGACTGGTCTGAGCTATACCCAGAGTTCTTCGCTCCACTCACTCAAAATCAGAGCCACGATGACCCAAAGGATAAGAAAGAAAAGAGAGCTCAGGCCCAAGTGGAGTTTGCAGACATAGGCTGTGGCTATGGTGGCCTGTTAGTGGAACTGTCACCGCTGTTCCCAGACACACTTATTCTGGGTCTGGAGATCCGGGTGAAGGTCTCAGACTATGTACAAGACCGGATTCGGGCCCTACGCGCAGCTCCTGCAGGTGGCTTCCAGAACATCGCCTGTCTCCGTAGCAATGCCATGAAGCACCTTCCTAACTTCTTCTACAAGGGCCAGCTGACAAAGATGTTCTTCCTCTTCCCCGACCCACATTTCAAGCGGACAAAGCACAAGTGGCGAATCATCAGTCCCACCCTGCTAGCAGAATATGCCTACGTGCTAAGAGTTGGGGGGCTGGTGTATACCATAACCGATGTGCTGGAGCTACACGACTGGATGTGCACTCATTTCGAAGAGCACCCACTGTTTGAGCGTGTGCCTCTGGAGGACCTGAGTGAAGACCCCGTTGTGGGACATCTAGGCACCTCAACTGAGGAGGGGAAGAAAGTTCTACGTAATGGAGGGAAGAATTTCCCAGCCATCTTCCGAAGAATACAAGATCCCGTCCTCCAGGCAGTGACCTCCCAAACCAGCCTGCCTGGTCACTGA

Additionnal Information

METTL1, C12orf1, TRM8, TRMT8, YDL201w, METTL1, ATGD0215-10 µg, ATGD0215-20 µg, ATGD0215-50 µg, ATGD0215-100 µg, ATGD0215-250 µg, ATGD0215-500 µg, ATGD0215-1 mg, ATGD0215-10, ATGD0215-20, ATGD0215-50, ATGD0215-100, ATGD0215-250, ATGD0215-500, ATGD0215-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Enzymes & Proteases

Omim

604466

NCBI Accession Number

NP_005362.3

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_005371.5

DNA Size

831bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Strip1 (NM_153563) Mouse Recombinant Protein
PM45216M5 20 µg

Strip1 (NM_153563) Mouse Recombinant Protein

Sign In for Pricing
View Details
AF 568 DBCO, 50 mg
5158F0 50 mg

AF 568 DBCO, 50 mg

Sign In for Pricing
View Details
SRP72 CRISPRa sgRNA lentivector (set of three targets)(Rat)
45485126 3x 1.0µg DNA

SRP72 CRISPRa sgRNA lentivector (set of three targets)(Rat)

Sign In for Pricing
View Details
SPP1 Polyclonal Antibody
MBS8568762-01 0.1 mL

SPP1 Polyclonal Antibody

Sign In for Pricing
View Details
SPP1 Polyclonal Antibody
MBS8568762-02 0.1 mL (AF405L)

SPP1 Polyclonal Antibody

Sign In for Pricing
View Details
SPP1 Polyclonal Antibody
MBS8568762-03 0.1 mL (AF405S)

SPP1 Polyclonal Antibody

Sign In for Pricing
View Details