Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CYCS cDNA

CYCS encodes a small heme protein that functions as a central component of the electron transport chain in mitochondria. The encoded protein associates with the inner membrane of the mitochondrion where it accepts electrons from cytochrome b and transfers them to the cytochrome oxidase complex. This protein is also involved in initiation of apoptosis. Mutations in this gene are associated with autosomal dominant nonsyndromic thrombocytopenia. Numerous processed pseudogenes of this gene are found throughout the human genome.

Product Specifications

Product Name Alternative

CYC, HCS, THC4, Cytochrome c

Chromosomal Location

7p15.3

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGGGTGATGTTGAGAAAGGCAAGAAGATTTTTATTATGAAGTGTTCCCAGTGCCACACCGTTGAAAAGGGAGGCAAGCACAAGACTGGGCCAAATCTCCATGGTCTCTTTGGGCGGAAGACAGGTCAGGCCCCTGGATACTCTTACACAGCCGCCAATAAGAACAAAGGCATCATCTGGGGAGAGGATACACTGATGGAGTATTTGGAGAATCCCAAGAAGTACATCCCTGGAACAAAAATGATCTTTGTCGGCATTAAGAAGAAGGAAGAAAGGGCAGACTTAATAGCTTATCTCAAAAAAGCTACTAATGAGTAA

Additionnal Information

CYCS, CYC, HCS, THC4, CYCS, ATGD0213-10 µg, ATGD0213-20 µg, ATGD0213-50 µg, ATGD0213-100 µg, ATGD0213-250 µg, ATGD0213-500 µg, ATGD0213-1 mg, ATGD0213-10, ATGD0213-20, ATGD0213-50, ATGD0213-100, ATGD0213-250, ATGD0213-500, ATGD0213-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Cancer

Omim

123970

NCBI Accession Number

NP_061820.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_018947.5

DNA Size

318bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

PTPN20B Rabbit pAb
E2162090 100 µL

PTPN20B Rabbit pAb

Sign In for Pricing
View Details
Comfort MTP (HxD) 6x5=30 plates 55mm, 343x450x135mm
TE35634 1 Piece

Comfort MTP (HxD) 6x5=30 plates 55mm, 343x450x135mm

Sign In for Pricing
View Details
MRPS28 Protein Vector (Mouse) (pPB-C-His)
PV202238 500 ng

MRPS28 Protein Vector (Mouse) (pPB-C-His)

Sign In for Pricing
View Details
Human CDKN2B/p15INK4b Protein, His tag
S0A9061-01 100 µg

Human CDKN2B/p15INK4b Protein, His tag

Sign In for Pricing
View Details
Human CDKN2B/p15INK4b Protein, His tag
S0A9061-02 1 mg

Human CDKN2B/p15INK4b Protein, His tag

Sign In for Pricing
View Details
Human CDKN2B/p15INK4b Protein, His tag
S0A9061-03 500 µg

Human CDKN2B/p15INK4b Protein, His tag

Sign In for Pricing
View Details