Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

COTL1 cDNA

COTL1 encodes one of the numerous actin-binding proteins which regulate the actin cytoskeleton. This protein binds F-actin, and also interacts with 5-lipoxygenase, which is the first committed enzyme in leukotriene biosynthesis. Although COTL1 has been reported to map to chromosome 17 in the Smith-Magenis syndrome region, the best alignments for this gene are to chromosome 16. The Smith-Magenis syndrome region is the site of two related pseudogenes.

Product Specifications

Product Name Alternative

CLP

Chromosomal Location

16q24.1

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGGCCACCAAGATCGACAAAGAGGCTTGCCGGGCGGCGTACAACCTGGTGCGCGACGACGGCTCGGCCGTCATCTGGGTGACTTTTAAATATGACGGCTCCACCATCGTCCCCGGCGAGCAGGGAGCGGAGTACCAGCACTTCATCCAGCAGTGCACAGATGACGTCCGGTTGTTTGCCTTCGTGCGCTTCACCACCGGGGATGCCATGAGCAAGAGGTCCAAGTTTGCCCTCATCACGTGGATCGGTGAGAACGTCAGCGGGCTGCAGCGCGCCAAAACCGGGACGGACAAGACCCTGGTGAAGGAGGTCGTACAGAATTTCGCTAAGGAGTTTGTGATCAGTGATCGGAAGGAGCTGGAGGAAGATTTCATCAAGAGCGAGCTGAAGAAGGCGGGGGGAGCCAATTACGACGCCCAGACGGAGTAA

Additionnal Information

COTL1, CLP, COTL1, ATGD0208-10 µg, ATGD0208-20 µg, ATGD0208-50 µg, ATGD0208-100 µg, ATGD0208-250 µg, ATGD0208-500 µg, ATGD0208-1 mg, ATGD0208-10, ATGD0208-20, ATGD0208-50, ATGD0208-100, ATGD0208-250, ATGD0208-500, ATGD0208-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Cytoskeleton

Omim

606748

NCBI Accession Number

NP_066972.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_021149.3

DNA Size

429bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

3-Formyl rifamycin 100mg
A19090-100 100 mg

3-Formyl rifamycin 100mg

Sign In for Pricing
View Details
Quick Step Rat Peroxiredoxin 5 (PRDX5) ELISA Kit
QS1443Ra-01 48 Tests

Quick Step Rat Peroxiredoxin 5 (PRDX5) ELISA Kit

Sign In for Pricing
View Details
Quick Step Rat Peroxiredoxin 5 (PRDX5) ELISA Kit
QS1443Ra-02 96 Tests

Quick Step Rat Peroxiredoxin 5 (PRDX5) ELISA Kit

Sign In for Pricing
View Details
Rabbit Anti COMP Polyclonal Affinity Purified (PBS with 0.02% sodium azide, 50% glycerol, pH7.3)(IHC)
MBS8423436 Inquire

Rabbit Anti COMP Polyclonal Affinity Purified (PBS with 0.02% sodium azide, 50% glycerol, pH7.3)(IHC)

Sign In for Pricing
View Details
Recombinant Bacillus subtilis 3-oxoacyl-[acyl-carrier-protein] synthase 2 (fabF)
MBS9423331-01 0.02 mg

Recombinant Bacillus subtilis 3-oxoacyl-[acyl-carrier-protein] synthase 2 (fabF)

Sign In for Pricing
View Details
Recombinant Bacillus subtilis 3-oxoacyl-[acyl-carrier-protein] synthase 2 (fabF)
MBS9423331-02 0.1 mg

Recombinant Bacillus subtilis 3-oxoacyl-[acyl-carrier-protein] synthase 2 (fabF)

Sign In for Pricing
View Details