What is the catalog number for RAB35 cDNA?

The catalog number for RAB35 cDNA is ATGD0207-010.

What sizes are available for RAB35 cDNA?

RAB35 cDNA is available in the following size(s): 10 µg.

Is RAB35 cDNA in stock?

RAB35 cDNA is currently made to order / not held in immediate stock. Contact us for lead time.

RAB35 cDNA

The small GTPases Rab are key regulators of intracellular membrane trafficking, from the formation of transport vesicles to their fusion with membranes. Rabs cycle between an inactive GDP-bound form and an active GTP-bound form that is able to recruit to membranes different sets of downstream effectors directly responsible for vesicle formation, movement, tethering and fusion. That Rab is involved in the process of endocytosis and is an essential rate-limiting regulator of the fast recycling pathway back to the plasma membrane. During cytokinesis, required for the postfurrowing terminal steps, namely for intercellular bridge stability and abscission, possibly by controlling phosphatidylinositol 4, 5-bis phosphate (PIP2) and SEPT2 localization at the intercellular bridge. May indirectly regulate neurite outgrowth.

Product Specifications

Product Name Alternative

H-ray, RAB1C, RAY

Chromosomal Location

12q24.31

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGGCCCGGGACTACGACCACCTCTTCAAGCTGCTCATCATCGGCGACAGCGGTGTGGGCAAGAGCAGTTTACTGTTGCGTTTTGCAGACAACACTTTCTCAGGCAGCTACATCACCACGATCGGAGTGGATTTCAAGATCCGGACCGTGGAGATCAACGGGGAGAAGGTGAAGCTGCAGATCTGGGACACAGCGGGGCAGGAGCGCTTCCGCACCATCACCTCCACGTATTATCGGGGGACCCACGGGGTCATTGTGGTTTACGACGTCACCAGTGCCGAGTCCTTTGTCAACGTCAAGCGGTGGCTTCACGAAATCAACCAGAACTGTGATGATGTGTGCCGAATATTAGTGGGTAATAAGAATGACGACCCTGAGCGGAAGGTGGTGGAGACGGAAGATGCCTACAAATTCGCCGGGCAGATGGGCATCCAGTTGTTCGAGACCAGCGCCAAGGAGAATGTCAACGTGGAAGAGATGTTCAACTGCATCACGGAGCTGGTCCTCCGAGCAAAGAAAGACAACCTGGCAAAACAGCAGCAGCAACAACAGAACGATGTGGTGAAGCTCACGAAGAACAGTAAACGAAAGAAACGCTGCTGCTAA

Additionnal Information

RAB35, H-ray, RAB1C, RAY, RAB35, ATGD0207-10 µg, ATGD0207-20 µg, ATGD0207-50 µg, ATGD0207-100 µg, ATGD0207-250 µg, ATGD0207-500 µg, ATGD0207-1 mg, ATGD0207-10, ATGD0207-20, ATGD0207-50, ATGD0207-100, ATGD0207-250, ATGD0207-500, ATGD0207-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Signal Transduction

Omim

604199

NCBI Accession Number

NP_006852.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_006861.6

DNA Size

624bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.