Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

RAB6B cDNA

RAB6B (RAB6B, Member RAS Oncogene Family) is a Protein Coding gene. Among its related pathways are Sertoli-Sertoli Cell Junction Dynamics.

Product Specifications

Chromosomal Location

3q22.1

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGTCCGCAGGGGGAGATTTTGGGAATCCACTGAGAAAATTCAAGTTGGTGTTCTTGGGGGAGCAGAGCGTCGGGAAGACGTCTCTGATTACGAGGTTCATGTACGACAGCTTCGACAACACATACCAGGCAACCATTGGGATTGACTTCTTGTCAAAAACCATGTACTTGGAGGACCGCACGGTGCGACTGCAGCTCTGGGACACAGCTGGTCAGGAGAGGTTCCGCAGCCTGATCCCCAGCTACATCCGGGACTCCACGGTGGCTGTGGTGGTGTACGACATCACAAATCTCAACTCCTTCCAACAGACCTCTAAGTGGATCGACGACGTCAGGACAGAGAGGGGCAGTGATGTTATCATCATGCTGGTGGGCAACAAGACGGACCTGGCTGATAAGAGGCAGATAACCATCGAGGAGGGGGAGCAGCGCGCCAAAGAACTGAGCGTCATGTTCATTGAGACCAGTGCGAAGACTGGCTACAACGTGAAGCAGCTTTTTCGACGTGTGGCGTCGGCTCTACCCGGAATGGAGAATGTCCAGGAGAAAAGCAAAGAAGGGATGATCGACATCAAGCTGGACAAACCCCAGGAGCCCCCGGCCAGCGAGGGCGGCTGCTCCTGCTAA

Additionnal Information

RAB6B, RAB6B, ATGD0206-10 µg, ATGD0206-20 µg, ATGD0206-50 µg, ATGD0206-100 µg, ATGD0206-250 µg, ATGD0206-500 µg, ATGD0206-1 mg, ATGD0206-10, ATGD0206-20, ATGD0206-50, ATGD0206-100, ATGD0206-250, ATGD0206-500, ATGD0206-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Signal Transduction

Omim

615852

NCBI Accession Number

NP_057661.3

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_016577.3

DNA Size

627bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
More Discoveries

Explore Other Products

Browse additional items from our catalog

Rabbit anti-human Phosphatidylglycerophosphatase and protein-tyrosine phosphatase 1 polyclonal Antibody, HRP conjugated
MBS1499872-01 0.05 mg

Rabbit anti-human Phosphatidylglycerophosphatase and protein-tyrosine phosphatase 1 polyclonal Antibody, HRP conjugated

Sign In for Pricing
View Details
Rabbit anti-human Phosphatidylglycerophosphatase and protein-tyrosine phosphatase 1 polyclonal Antibody, HRP conjugated
MBS1499872-02 0.1 mg

Rabbit anti-human Phosphatidylglycerophosphatase and protein-tyrosine phosphatase 1 polyclonal Antibody, HRP conjugated

Sign In for Pricing
View Details
Rabbit anti-human Phosphatidylglycerophosphatase and protein-tyrosine phosphatase 1 polyclonal Antibody, HRP conjugated
MBS1499872-03 5x 0.1 mg

Rabbit anti-human Phosphatidylglycerophosphatase and protein-tyrosine phosphatase 1 polyclonal Antibody, HRP conjugated

Sign In for Pricing
View Details
Biotin anti-mouse CD8b.2
E16FMB008b.2-500U 500 µg

Biotin anti-mouse CD8b.2

Sign In for Pricing
View Details
Fbxo12 shRNA (m) Lentiviral Particles
sc-145103-V 200 µL

Fbxo12 shRNA (m) Lentiviral Particles

Sign In for Pricing
View Details
KIAA0247 Protein Vector (Human) (pPM-C-His)
PV022388 500 ng

KIAA0247 Protein Vector (Human) (pPM-C-His)

Sign In for Pricing
View Details