Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

RAB7A cDNA

RAB family members are small, RAS-related GTP-binding proteins that are important regulators of vesicular transport. Each RAB protein targets multiple proteins that act in exocytic / endocytic pathways. RAB7A encodes a RAB family member that regulates vesicle traffic in the late endosomes and also from late endosomes to lysosomes. This encoded RAB7A is also involved in the cellular vacuolation of the VacA cytotoxin of Helicobacter pylori. Mutations at highly conserved amino acid residues in RAB7A have caused some forms of Charcot-Marie-Tooth (CMT) type 2 neuropathies.

Product Specifications

Product Name Alternative

PRO2706, RAB7

Chromosomal Location

3q21.3

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGACCTCTAGGAAGAAAGTGTTGCTGAAGGTTATCATCCTGGGAGATTCTGGAGTCGGGAAGACATCACTCATGAACCAGTATGTGAATAAGAAATTCAGCAATCAGTACAAAGCCACAATAGGAGCTGACTTTCTGACCAAGGAGGTGATGGTGGATGACAGGCTAGTCACAATGCAGATATGGGACACAGCAGGACAGGAACGGTTCCAGTCTCTCGGTGTGGCCTTCTACAGAGGTGCAGACTGCTGCGTTCTGGTATTTGATGTGACTGCCCCCAACACATTCAAAACCCTAGATAGCTGGAGAGATGAGTTTCTCATCCAGGCCAGTCCCCGAGATCCTGAAAACTTCCCATTTGTTGTGTTGGGAAACAAGATTGACCTCGAAAACAGACAAGTGGCCACAAAGCGGGCACAGGCCTGGTGCTACAGCAAAAACAACATTCCCTACTTTGAGACCAGTGCCAAGGAGGCCATCAACGTGGAGCAGGCGTTCCAGACGATTGCACGGAATGCACTTAAGCAGGAAACGGAGGTGGAGCTGTACAACGAATTTCCTGAACCTATCAAACTGGACAAGAATGACCGGGCCAAGGCCTCGGCAGAAAGCTGCAGTTGCTGA

Additionnal Information

RAB7A, PRO2706, RAB7, RAB7A, ATGD0205-10 µg, ATGD0205-20 µg, ATGD0205-50 µg, ATGD0205-100 µg, ATGD0205-250 µg, ATGD0205-500 µg, ATGD0205-1 mg, ATGD0205-10, ATGD0205-20, ATGD0205-50, ATGD0205-100, ATGD0205-250, ATGD0205-500, ATGD0205-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Signal Transduction

Omim

602298

NCBI Accession Number

NP_004628.4

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_004637.5

DNA Size

624bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

DI3L1, NT (DIS3L, DIS3L1, KIAA1955, DIS3-like exonuclease 1) (Biotin)
MBS6292137-01 0.2 mL

DI3L1, NT (DIS3L, DIS3L1, KIAA1955, DIS3-like exonuclease 1) (Biotin)

Sign In for Pricing
View Details
DI3L1, NT (DIS3L, DIS3L1, KIAA1955, DIS3-like exonuclease 1) (Biotin)
MBS6292137-02 5x 0.2 mL

DI3L1, NT (DIS3L, DIS3L1, KIAA1955, DIS3-like exonuclease 1) (Biotin)

Sign In for Pricing
View Details
C-Met (Phospho-Y1349) Rabbit Monoclonal Antibody
orb2988907-01 30 µL

C-Met (Phospho-Y1349) Rabbit Monoclonal Antibody

Sign In for Pricing
View Details
C-Met (Phospho-Y1349) Rabbit Monoclonal Antibody
orb2988907-02 50 µL

C-Met (Phospho-Y1349) Rabbit Monoclonal Antibody

Sign In for Pricing
View Details
C-Met (Phospho-Y1349) Rabbit Monoclonal Antibody
orb2988907-03 100 µL

C-Met (Phospho-Y1349) Rabbit Monoclonal Antibody

Sign In for Pricing
View Details
C-Met (Phospho-Y1349) Rabbit Monoclonal Antibody
orb2988907-04 200 µL

C-Met (Phospho-Y1349) Rabbit Monoclonal Antibody

Sign In for Pricing
View Details