Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

CHMP4A cDNA

CHMP4A belongs to the chromatin-modifying protein/charged multivesicular body protein (CHMP) family. CHMP4A are components of ESCRT-III (endosomal sorting complex required for transport III), a complex involved in degradation of surface receptor proteins and formation of endocytic multivesicular bodies (MVBs) . Some CHMPs have both nuclear and cytoplasmic/vesicular distributions, and one such CHMP, CHMP1A (MIM 164010), is required for both MVB formation and regulation of cell cycle progression

Product Specifications

Product Name Alternative

C14orf123, CHMP4, CHMP4B, HSPC134, SHAX2, SNF7, SNF7-1, VPS32-1, VPS32A

Chromosomal Location

14q12

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGTCGCGGCGGCGCCCTGAGGACGGATTGGGCAAGGCTGGTCCCTGTGTGATGAGACATCACCCTCCCAGGAGCAAGGCGGAAGTCTGGAGGACGCTGAGGGGCGGAGGCGGGAGAGGCGAGCTCGCGATGAGTGGTCTCGGCAGGCTCTTCGGGAAGGGGAAGAAGGAGAAAGGGCCAACCCCTGAAGAAGCAATACAGAAACTGAAGGAGACAGAGAAGATACTGATCAAGAAACAGGAATTTTTGGAGCAGAAGATTCAACAGGAGCTACAAACAGCCAAGAAGTATGGGACCAAGAATAAGAGAGCTGCCCTACAGGCTTTGCGGAGGAAGAAAAGATTCGAACAGCAGCTGGCACAAACTGACGGGACATTATCCACCCTGGAGTTTCAGCGTGAGGCCATTGAGAATGCCACTACCAATGCAGAAGTCCTTCGTACCATGGAGCTTGCTGCCCAAAGCATGAAGAAGGCCTACCAGGACATGGACATTGACAAGGTAGATGAACTGATGACTGACATCACGGAACAACAGGAGGTGGCCCAGCAGATCTCAGATGCCATTTCTCGGCCTATGGGCTTTGGAGATGATGTGGATGAGGATGAACTGCTGGAGGAGCTAGAGGAGCTGGAGCAGGAGGAATTGGCCCAGGAGTTGTTAAATGTGGGCGACAAGGAAGAAGAACCCTCAGTCAAATTGCCTAGTGTACCTTCTACTCATCTGCCGGCAGGGCCAGCTCCCAAAGTGGATGAAGATGAAGAAGCACTAAAGCAGTTGGCTGAGTGGGTATCCTGA

Additionnal Information

CHMP4A, C14orf123, CHMP4, CHMP4B, HSPC134, SHAX2, SNF7, SNF7-1, VPS32-1, VPS32A, CHMP4A, ATGD0199-10 µg, ATGD0199-20 µg, ATGD0199-50 µg, ATGD0199-100 µg, ATGD0199-250 µg, ATGD0199-500 µg, ATGD0199-1 mg, ATGD0199-10, ATGD0199-20, ATGD0199-50, ATGD0199-100, ATGD0199-250, ATGD0199-500, ATGD0199-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Metabolism

Omim

610051

NCBI Accession Number

NP_054888.2

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_014169.3

DNA Size

798bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted Nde I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

pCMV-SPORT6-WDR92 Plasmid
PVT22800 2 µg

pCMV-SPORT6-WDR92 Plasmid

Sign In for Pricing
View Details
Human PMS2P1 qPCR Primer Pair
QH20325S 200 Tests

Human PMS2P1 qPCR Primer Pair

Sign In for Pricing
View Details
Tubulin-specific chaperone coFactor E-Like protein (TBCEL) Human ELISA Kit
H9272 96 Tests

Tubulin-specific chaperone coFactor E-Like protein (TBCEL) Human ELISA Kit

Sign In for Pricing
View Details
NOTCH2 Rabbit Polyclonal Antibody
TA331126 100 µL

NOTCH2 Rabbit Polyclonal Antibody

Sign In for Pricing
View Details
Acadsb (NM_013084) Rat Tagged Lenti ORF Clone
RR204129L2 10 µg

Acadsb (NM_013084) Rat Tagged Lenti ORF Clone

Sign In for Pricing
View Details
RINT1 AAV Vector (Mouse) (CMV)
39604104 1 µg

RINT1 AAV Vector (Mouse) (CMV)

Sign In for Pricing
View Details