Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

ARF3 cDNA

ADP-ribosylation factor 3 (ARF3) is a member of the human ARF gene family. These genes encode small guanine nucleotide-binding proteins that stimulate the ADP-ribosyltransferase activity of cholera toxin and play a role in vesicular trafficking and as activators of phospholipase D. The gene products include 6 ARF proteins and 11 ARF-like proteins and constitute 1 family of the RAS superfamily. The ARF proteins are categorized as class I (ARF1, ARF2, and ARF3), class II (ARF4 and ARF5) and class III (ARF6) and members of each class share a common gene organization. The ARF3 gene contains five exons and four introns.

Product Specifications

Chromosomal Location

12q13

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGGGCAATATCTTTGGAAACCTTCTCAAGAGCCTGATTGGGAAGAAGGAGATGCGCATCCTGATGGTGGGCCTGGATGCCGCAGGAAAGACCACCATCCTATACAAGCTGAAACTGGGGGAGATCGTCACCACCATCCCTACCATTGGGTTCAATGTGGAGACAGTGGAGTATAAGAACATCAGCTTTACAGTGTGGGATGTGGGTGGCCAGGACAAGATTCGACCCCTCTGGAGACACTACTTCCAGAACACCCAAGGGTTGATATTTGTGGTCGACAGCAATGATCGGGAGCGAGTAAATGAGGCCCGGGAAGAGCTGATGAGAATGCTGGCGGAGGACGAGCTCCGGGATGCTGTACTCCTTGTCTTTGCAAACAAACAGGATCTGCCTAATGCTATGAACGCTGCTGAGATCACAGACAAGCTGGGCCTGCATTCCCTTCGTCACCGTAACTGGTACATTCAGGCCACCTGTGCCACCAGCGGGGACGGGCTGTACGAAGGCCTGGACTGGCTGGCCAATCAGCTCAAAAACAAGAAGTGA

Additionnal Information

ARF3, ARF3, ATGD0194-10 µg, ATGD0194-20 µg, ATGD0194-50 µg, ATGD0194-100 µg, ATGD0194-250 µg, ATGD0194-500 µg, ATGD0194-1 mg, ATGD0194-10, ATGD0194-20, ATGD0194-50, ATGD0194-100, ATGD0194-250, ATGD0194-500, ATGD0194-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Signal Transduction

Omim

103190

NCBI Accession Number

NP_001650.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_001659.2

DNA Size

546bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Rabbit anti-FOX2/RBM9 Recombinant Monoclonal Antibody [BLR215K)
A700-215-T 10 µL (5+ Tests)

Rabbit anti-FOX2/RBM9 Recombinant Monoclonal Antibody [BLR215K)

Sign In for Pricing
View Details
WWamide-1 Peptide
abx265990-01 5 mg

WWamide-1 Peptide

Sign In for Pricing
View Details
WWamide-1 Peptide
abx265990-02 10 mg

WWamide-1 Peptide

Sign In for Pricing
View Details
WWamide-1 Peptide
abx265990-03 25 mg

WWamide-1 Peptide

Sign In for Pricing
View Details
14,15-EE-8 (Z) -E
orb1985080-01 25 µg

14,15-EE-8 (Z) -E

Sign In for Pricing
View Details
14,15-EE-8 (Z) -E
orb1985080-02 50 µg

14,15-EE-8 (Z) -E

Sign In for Pricing
View Details