Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

ARF4 cDNA

ARF4 is a member of the human ARF gene family whose members encode small guanine nucleotide-binding proteins that stimulate the ADP-ribosyltransferase activity of cholera toxin and play a role in vesicular trafficking and as activators of phospholipase D. The gene products include 5 ARF proteins and 11 ARF-like proteins and constitute one family of the RAS superfamily. The ARF proteins are categorized as class I, class II and class III; this gene is a class II member. The members of each class share a common gene organization. The ARF4 gene spans approximately 12kb and contains six exons and five introns. This gene is the most divergent member of the human ARFs. Conflicting map positions at 3p14 or 3p21 have been reported for this gene.

Product Specifications

Product Name Alternative

ARF2

Chromosomal Location

3p14.3

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGGGCCTCACTATCTCCTCCCTCTTCTCCCGACTATTTGGCAAGAAGCAGATGCGCATTTTGATGGTTGGATTGGATGCTGCTGGCAAGACAACCATTCTGTATAAACTGAAGTTAGGGGAGATAGTCACCACCATTCCTACCATTGGTTTTAATGTGGAAACAGTAGAATATAAGAACATTTGTTTCACAGTATGGGATGTTGGTGGTCAAGATAGAATTAGGCCTCTCTGGAAGCATTACTTCCAGAATACCCAGGGTCTTATTTTTGTGGTAGATAGCAACGATCGTGAAAGAATTCAGGAAGTAGCAGATGAGCTGCAGAAAATGCTTCTGGTAGATGAATTGAGAGATGCAGTGCTGCTACTTTTTGCAAACAAACAGGATTTGCCAAATGCTATGGCCATCAGTGAAATGACAGATAAACTAGGGCTTCAGTCTCTTCGTAACAGAACATGGTATGTTCAAGCCACTTGTGCAACACAAGGAACTGGTCTGTATGAAGGACTTGACTGGCTGTCAAATGAGCTTTCAAAACGTTAA

Additionnal Information

ARF4, ARF2, ARF4, ATGD0193-10 µg, ATGD0193-20 µg, ATGD0193-50 µg, ATGD0193-100 µg, ATGD0193-250 µg, ATGD0193-500 µg, ATGD0193-1 mg, ATGD0193-10, ATGD0193-20, ATGD0193-50, ATGD0193-100, ATGD0193-250, ATGD0193-500, ATGD0193-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Signal Transduction

Omim

601177

NCBI Accession Number

NP_001651.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_001660.3

DNA Size

543bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
More Discoveries

Explore Other Products

Browse additional items from our catalog

beta-Amyloid (1-42), acetate (human)
MBS5827266 Inquire

beta-Amyloid (1-42), acetate (human)

Sign In for Pricing
View Details
Rcan1 3'UTR Luciferase Stable Cell Line
TU217419 1.0 mL

Rcan1 3'UTR Luciferase Stable Cell Line

Sign In for Pricing
View Details
AHCY Rabbit pAb
E45R20731N-100 100 µL

AHCY Rabbit pAb

Sign In for Pricing
View Details
Olfr459 Recombinant Protein (Mouse)
RP157907 100 µg

Olfr459 Recombinant Protein (Mouse)

Sign In for Pricing
View Details
Fbxo41 ORF Vector (Mouse) (pORF)
ORF044678 1.0 µg DNA

Fbxo41 ORF Vector (Mouse) (pORF)

Sign In for Pricing
View Details
VPS26A Rabbit pAb
MBS8538101-01 0.1 mL

VPS26A Rabbit pAb

Sign In for Pricing
View Details