Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

RAB2A cDNA

The protein encoded by RAB2A belongs to the Rab family, members of which are small molecular weight guanosine triphosphatases (GTPases) that contain highly conserved domains involved in GTP binding and hydrolysis. The Rabs are membrane-bound proteins, involved in vesicular fusion and trafficking. This protein is a resident of pre-Golgi intermediates, and is required for protein transport from the endoplasmic reticulum (ER) to the Golgi complex. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Product Specifications

Product Name Alternative

LHX, RAB2

Chromosomal Location

8q12.1

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGGCGTACGCCTATCTCTTCAAGTACATCATAATCGGCGACACAGGTGTTGGTAAATCATGCTTATTGCTACAGTTTACAGACAAGAGGTTTCAGCCAGTGCATGACCTTACTATTGGTGTAGAGTTCGGTGCTCGAATGATAACTATTGATGGGAAACAGATAAAACTTCAGATATGGGATACGGCAGGGCAAGAATCCTTTCGTTCCATCACAAGGTCGTATTACAGAGGTGCAGCAGGAGCTTTACTAGTTTACGATATTACACGGAGAGATACATTCAACCACTTGACAACCTGGTTAGAAGATGCCCGCCAGCATTCCAATTCCAACATGGTCATTATGCTTATTGGAAATAAAAGTGATTTAGAATCTAGAAGAGAAGTAAAAAAAGAAGAAGGTGAAGCTTTTGCACGAGAACATGGACTCATCTTCATGGAAACGTCTGCTAAGACTGCTTCCAATGTAGAAGAGGCATTTATTAATACAGCAAAAGAAATTTATGAAAAAATTCAAGAAGGAGTCTTTGACATTAATAATGAGGCAAATGGCATTAAAATTGGCCCTCAGCATGCTGCTACCAATGCAACACATGCAGGCAATCAGGGAGGACAGCAGGCTGGGGGCGGCTGCTGTTGA

Additionnal Information

RAB2A, LHX, RAB2, RAB2A, ATGD0179-10 µg, ATGD0179-20 µg, ATGD0179-50 µg, ATGD0179-100 µg, ATGD0179-250 µg, ATGD0179-500 µg, ATGD0179-1 mg, ATGD0179-10, ATGD0179-20, ATGD0179-50, ATGD0179-100, ATGD0179-250, ATGD0179-500, ATGD0179-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Signal Transduction

Omim

179509

NCBI Accession Number

NP_002856.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_002865.2

DNA Size

639bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Recombinant Photorhabdus luminescens subsp. laumondii UPF0306 protein plu4501 (plu4501)
MBS1394842-01 0.02 mg (E-Coli)

Recombinant Photorhabdus luminescens subsp. laumondii UPF0306 protein plu4501 (plu4501)

Sign In for Pricing
View Details
Recombinant Photorhabdus luminescens subsp. laumondii UPF0306 protein plu4501 (plu4501)
MBS1394842-02 0.1 mg (E-Coli)

Recombinant Photorhabdus luminescens subsp. laumondii UPF0306 protein plu4501 (plu4501)

Sign In for Pricing
View Details
Recombinant Photorhabdus luminescens subsp. laumondii UPF0306 protein plu4501 (plu4501)
MBS1394842-03 0.02 mg (Yeast)

Recombinant Photorhabdus luminescens subsp. laumondii UPF0306 protein plu4501 (plu4501)

Sign In for Pricing
View Details
Recombinant Photorhabdus luminescens subsp. laumondii UPF0306 protein plu4501 (plu4501)
MBS1394842-04 0.1 mg (Yeast)

Recombinant Photorhabdus luminescens subsp. laumondii UPF0306 protein plu4501 (plu4501)

Sign In for Pricing
View Details
Recombinant Photorhabdus luminescens subsp. laumondii UPF0306 protein plu4501 (plu4501)
MBS1394842-05 0.02 mg (Baculovirus)

Recombinant Photorhabdus luminescens subsp. laumondii UPF0306 protein plu4501 (plu4501)

Sign In for Pricing
View Details
Recombinant Photorhabdus luminescens subsp. laumondii UPF0306 protein plu4501 (plu4501)
MBS1394842-06 0.02 mg (Mammalian-Cell)

Recombinant Photorhabdus luminescens subsp. laumondii UPF0306 protein plu4501 (plu4501)

Sign In for Pricing
View Details