Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

GINS2 cDNA

The yeast heterotetrameric GINS complex is made up of Sld5 (GINS4; MIM 610611), Psf1 (GINS1; MIM 610608), Psf2, and Psf3 (GINS3; MIM 610610) . The formation of this complex is essential for the initiation of DNA replication in yeast and Xenopus egg extracts

Product Specifications

Product Name Alternative

HSPC037, Pfs2, PSF2

Chromosomal Location

16q24.1

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGGACGCTGCCGAGGTCGAATTCCTCGCCGAGAAGGAGCTGGTTACCATTATCCCCAACTTCAGTCTGGACAAGATCTACCTCATCGGGGGGGACCTGGGGCCTTTTAACCCTGGTTTACCCGTGGAAGTGCCCCTGTGGCTGGCGATTAACCTGAAACAAAGACAGAAATGTCGCCTGCTCCCTCCAGAGTGGATGGATGTAGAAAAGTTGGAGAAGATGAGGGATCATGAACGAAAGGAAGAAACTTTTACCCCAATGCCCAGCCCTTACTACATGGAACTTACGAAGCTCCTGTTAAATCATGCTTCAGACAACATCCCGAAGGCAGACGAAATCCGGACCCTGGTCAAGGATATGTGGGACACTCGTATAGCCAAACTCCGAGTGTCTGCTGACAGCTTTGTGAGACAGCAGGAGGCACATGCCAAGCTGGATAACTTGACCTTGATGGAGATCAACACCAGCGGGACTTTCCTCACACAAGCGCTCAACCACATGTACAAACTCCGCACGAACCTCCAGCCTCTGGAGAGTACTCAGTCTCAGGACTTCTAG

Additionnal Information

GINS2, HSPC037, Pfs2, PSF2, GINS2, ATGD0176-10 µg, ATGD0176-20 µg, ATGD0176-50 µg, ATGD0176-100 µg, ATGD0176-250 µg, ATGD0176-500 µg, ATGD0176-1 mg, ATGD0176-10, ATGD0176-20, ATGD0176-50, ATGD0176-100, ATGD0176-250, ATGD0176-500, ATGD0176-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Cell Cycle

Omim

610609

NCBI Accession Number

NP_057179.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_016095.2

DNA Size

558bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

EPN1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0688205 3x 1.0 µg

EPN1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

Sign In for Pricing
View Details
Recombinant Rickettsia typhi Uncharacterized lipoprotein RT0080 (RT0080)
MBS1475969-01 0.02 mg (E-Coli)

Recombinant Rickettsia typhi Uncharacterized lipoprotein RT0080 (RT0080)

Sign In for Pricing
View Details
Recombinant Rickettsia typhi Uncharacterized lipoprotein RT0080 (RT0080)
MBS1475969-02 0.1 mg (E-Coli)

Recombinant Rickettsia typhi Uncharacterized lipoprotein RT0080 (RT0080)

Sign In for Pricing
View Details
Recombinant Rickettsia typhi Uncharacterized lipoprotein RT0080 (RT0080)
MBS1475969-03 0.02 mg (Yeast)

Recombinant Rickettsia typhi Uncharacterized lipoprotein RT0080 (RT0080)

Sign In for Pricing
View Details
Recombinant Rickettsia typhi Uncharacterized lipoprotein RT0080 (RT0080)
MBS1475969-04 0.1 mg (Yeast)

Recombinant Rickettsia typhi Uncharacterized lipoprotein RT0080 (RT0080)

Sign In for Pricing
View Details
Recombinant Rickettsia typhi Uncharacterized lipoprotein RT0080 (RT0080)
MBS1475969-05 0.02 mg (Baculovirus)

Recombinant Rickettsia typhi Uncharacterized lipoprotein RT0080 (RT0080)

Sign In for Pricing
View Details