Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

DDIT4 cDNA

DDIT4 (DNA-Damage-Inducible Transcript 4) is a Protein Coding gene. Diseases associated with DDIT4 include renal cell carcinoma. Among its related pathways are PI3K-Akt signaling pathway and p70S6K Signaling.

Product Specifications

Product Name Alternative

Dig2, REDD-1, REDD1

Chromosomal Location

10q22.1

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGCCTAGCCTTTGGGACCGCTTCTCGTCGTCGTCCACCTCCTCTTCGCCCTCGTCCTTGCCCCGAACTCCCACCCCAGATCGGCCGCCGCGCTCAGCCTGGGGGTCGGCGACCCGGGAGGAGGGGTTTGACCGCTCCACGAGCCTGGAGAGCTCGGACTGCGAGTCCCTGGACAGCAGCAACAGTGGCTTCGGGCCGGAGGAAGACACGGCTTACCTGGATGGGGTGTCGTTGCCCGACTTCGAGCTGCTCAGTGACCCTGAGGATGAACACTTGTGTGCCAACCTGATGCAGCTGCTGCAGGAGAGCCTGGCCCAGGCGCGGCTGGGCTCTCGACGCCCTGCGCGCCTGCTGATGCCTAGCCAGTTGGTAAGCCAGGTGGGCAAAGAACTACTGCGCCTGGCCTACAGCGAGCCGTGCGGCCTGCGGGGGGCGCTGCTGGACGTCTGCGTGGAGCAGGGCAAGAGCTGCCACAGCGTGGGCCAGCTGGCACTCGACCCCAGCCTGGTGCCCACCTTCCAGCTGACCCTCGTGCTGCGCCTGGACTCACGACTCTGGCCCAAGATCCAGGGGCTGTTTAGCTCCGCCAACTCTCCCTTCCTCCCTGGCTTCAGCCAGTCCCTGACGCTGAGCACTGGCTTCCGAGTCATCAAGAAGAAGCTGTACAGCTCGGAACAGCTGCTCATTGAGGAGTGTTGA

Additionnal Information

DDIT4, Dig2, REDD-1, REDD1, DDIT4, ATGD0169-10 µg, ATGD0169-20 µg, ATGD0169-50 µg, ATGD0169-100 µg, ATGD0169-250 µg, ATGD0169-500 µg, ATGD0169-1 mg, ATGD0169-10, ATGD0169-20, ATGD0169-50, ATGD0169-100, ATGD0169-250, ATGD0169-500, ATGD0169-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Cancer

Omim

607729

NCBI Accession Number

NP_061931.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_019058.2

DNA Size

699bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
More Discoveries

Explore Other Products

Browse additional items from our catalog

ZCCHC8 (NM_017612) Human Tagged Lenti ORF Clone
RC209528L4 10 µg

ZCCHC8 (NM_017612) Human Tagged Lenti ORF Clone

Sign In for Pricing
View Details
L-type Ca++ CP γ7 Double Nickase Plasmid (h)
sc-408269-NIC 20 µg

L-type Ca++ CP γ7 Double Nickase Plasmid (h)

Sign In for Pricing
View Details
Lentiviral human MGST1 sgRNA gene knockout kit - Lentiviral human MGST1 sgRNA gene knockout kit (25)
GTR15393855 1 Vial

Lentiviral human MGST1 sgRNA gene knockout kit - Lentiviral human MGST1 sgRNA gene knockout kit (25)

Sign In for Pricing
View Details
IRS-2, CT (Insulin Receptor Substrate 2, IRS2)
I8700-18C 200 µL

IRS-2, CT (Insulin Receptor Substrate 2, IRS2)

Sign In for Pricing
View Details
ZNF232 Peptide - N-terminal region
MBS3226586-01 0.1 mg

ZNF232 Peptide - N-terminal region

Sign In for Pricing
View Details
ZNF232 Peptide - N-terminal region
MBS3226586-02 5x 0.1 mg

ZNF232 Peptide - N-terminal region

Sign In for Pricing
View Details