Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

GSKIP cDNA

GSKIP encodes a protein that is involved as a negative regulator of GSK3-beta in the Wnt signaling pathway. The encoded protein may play a role in the retinoic acid signaling pathway by regulating the functional interactions between GSK3-beta, beta-catenin and cyclin D1, and it regulates the beta-catenin/N-cadherin pool. The encoded protein contains a GSK3-beta interacting domain (GID) in its C-terminus, which is similar to the GID of Axin. The protein also contains an evolutionarily conserved RII-binding domain, which facilitates binding with protein kinase-A and GSK3-beta, enabling its role as an A-kinase anchoring protein. Alternatively spliced transcript variants have been observed for this gene.

Product Specifications

Product Name Alternative

C14orf129, HSPC210

Chromosomal Location

14q32.2

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGGAAACAGACTGTAATCCCATGGAGCTAAGCAGTATGTCAGGATTTGAAGAAGGTTCAGAGCTGAACGGTTTTGAAGGAACTGACATGAAAGACATGAGGCTCGAAGCTGAAGCAGTTGTAAATGATGTTCTCTTTGCTGTTAACAACATGTTTGTCTCGAAAAGCCTGCGGTGTGCGGATGATGTGGCCTATATCAATGTGGAAACAAAGGAAAGAAACAGATATTGCCTAGAACTCACTGAAGCAGGGCTCAAGGTGGTAGGCTATGCTTTTGACCAGGTAGATGATCATTTACAGACTCCCTACCATGAAACAGTCTACTCCTTGTTGGATACACTCAGCCCCGCCTACCGAGAAGCATTTGGAAACGCACTGCTTCAAAGACTGGAAGCTTTGAAAAGAGATGGACAGTCATGA

Additionnal Information

GSKIP, C14orf129, HSPC210, GSKIP, ATGD0167-10 µg, ATGD0167-20 µg, ATGD0167-50 µg, ATGD0167-100 µg, ATGD0167-250 µg, ATGD0167-500 µg, ATGD0167-1 mg, ATGD0167-10, ATGD0167-20, ATGD0167-50, ATGD0167-100, ATGD0167-250, ATGD0167-500, ATGD0167-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Metabolism

NCBI Accession Number

NP_057556.2

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_016472.4

DNA Size

420bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

HOXD11 (Homeobox D11, Hox-4.6, mouse, Homolog of, Homeo box 4F, Homeo box D11, Homeobox Protein Hox-D11, HOX4, HOX4F) (APC)
207711-APC 100 µL

HOXD11 (Homeobox D11, Hox-4.6, mouse, Homolog of, Homeo box 4F, Homeo box D11, Homeobox Protein Hox-D11, HOX4, HOX4F) (APC)

Sign In for Pricing
View Details
Human Corin (CRN) ELISA Kit
SL1938Hu-01 48 Tests

Human Corin (CRN) ELISA Kit

Sign In for Pricing
View Details
Human Corin (CRN) ELISA Kit
SL1938Hu-02 96 Tests

Human Corin (CRN) ELISA Kit

Sign In for Pricing
View Details
Human Anti Prothrombin antibody (Anti PR Ab) ELISA Kit
CK-bio-24247-01 48 Tests

Human Anti Prothrombin antibody (Anti PR Ab) ELISA Kit

Sign In for Pricing
View Details
Human Anti Prothrombin antibody (Anti PR Ab) ELISA Kit
CK-bio-24247-02 96 Tests

Human Anti Prothrombin antibody (Anti PR Ab) ELISA Kit

Sign In for Pricing
View Details
RAGE Polyclonal Antibody
bs-0177R-01 20 µL

RAGE Polyclonal Antibody

Sign In for Pricing
View Details