Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

LAMTOR3 cDNA

MAPKSP1 encodes a scaffold protein that functions in the extracellular signal-regulated kinase (ERK) cascade. The protein is localized to late endosomes by the mitogen-activated protein-binding protein-interacting protein, and binds specifically to MAP kinase kinase MAP2K1/MEK1, MAP kinase MAPK3/ERK1, and MAP kinase MAPK1/ERK2. Studies of the orthologous gene in mouse indicate that it regulates late endosomal traffic and cell proliferation. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. A pseudogene of this gene is located on the long arm of chromosome 13.

Product Specifications

Product Name Alternative

MAP2K1IP1, MAPBP, MAPKSP1, MP1, PRO0633, Ragulator3

Chromosomal Location

4q23

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGGCGGATGACCTAAAGCGATTCTTGTATAAAAAGTTACCAAGTGTTGAAGGGCTCCATGCCATTGTTGTGTCAGATAGAGATGGAGTACCTGTTATTAAAGTGGCAAATGACAATGCTCCAGAGCATGCTTTGCGACCTGGTTTCTTATCCACTTTTGCCCTTGCAACAGACCAAGGAAGCAAACTTGGACTTTCCAAAAATAAAAGTATCATCTGTTACTATAACACCTACCAGGTGGTTCAATTTAATCGTTTACCTTTGGTGGTGAGTTTCATAGCCAGCAGCAGTGCCAATACAGGACTAATTGTCAGCCTAGAAAAGGAACTTGCTCCATTGTTTGAAGAACTGAGACAAGTTGTGGAAGTTTCTTAA

Additionnal Information

LAMTOR3, MAP2K1IP1, MAPBP, MAPKSP1, MP1, PRO0633, Ragulator3, ATGD0164-10 µg, ATGD0164-20 µg, ATGD0164-50 µg, ATGD0164-100 µg, ATGD0164-250 µg, ATGD0164-500 µg, ATGD0164-1 mg, ATGD0164-010, ATGD0164-020, ATGD0164-050, ATGD0164-100, ATGD0164-250, ATGD0164-500, ATGD0164-01M

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Signal Transduction

Omim

603296

NCBI Accession Number

NP_068805.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_021970.3

DNA Size

375bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
More Discoveries

Explore Other Products

Browse additional items from our catalog

AMA1 protein
30-1388 500 ug

AMA1 protein

Sign In for Pricing
View Details
SOD1 Polyclonal Antibody
ANT-14492-50ug 50 µg

SOD1 Polyclonal Antibody

Sign In for Pricing
View Details
Mouse Cyclin N terminal domain containing protein 1 (CNTD1) ELISA kit
GTR10449643 96 Well

Mouse Cyclin N terminal domain containing protein 1 (CNTD1) ELISA kit

Sign In for Pricing
View Details
Energy Conversion Kit
1100050 1 Each

Energy Conversion Kit

Sign In for Pricing
View Details
TKTL1 Peptide - middle region (AAP53676)
AAP53676-100UG 100 µg

TKTL1 Peptide - middle region (AAP53676)

Sign In for Pricing
View Details
Rybp ORF Vector (Mouse) (pORF)
ORF056590 1.0 µg DNA

Rybp ORF Vector (Mouse) (pORF)

Sign In for Pricing
View Details