Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

SCAND1 cDNA

SCAND1 encodes a SCAN box domain-containing protein. The SCAN domain is a highly conserved, leucine-rich motif of approximately 60 aa originally found within a subfamily of zinc finger proteins. This gene belongs to a family of genes that encode an isolated SCAN domain, but no zinc finger motif. This protein binds to and may regulate the function of the transcription factor myeloid zinc finger 1B. Alternate splicing results in multiple transcript variants.

Product Specifications

Product Name Alternative

RAZ1, SDP1

Chromosomal Location

20q11.1-q11.23

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGGCGGCTACGGAGCCGATCTTGGCGGCCACTGGGAGTCCCGCGGCGGTGCCACCGGAGAAACTGGAAGGAGCCGGTTCGAGCTCAGCCCCTGAGCGTAACTGTGTGGGCTCCTCGCTGCCAGAGGCCTCACCGCCTGCCCCTGAGCCTTCCAGTCCCAACGCCGCGGTCCCTGAAGCCATCCCTACGCCCCGAGCTGCGGCCTCCGCGGCCCTGGAGCTGCCTCTCGGGCCCGCACCCGTGAGCGTAGCGCCTCAGGCCGAAGCTGAAGCGCGCTCCACACCAGGCCCCGCCGGCTCTAGACTCGGTCCCGAGACGTTCCGCCAGCGTTTCCGGCAGTTCCGCTACCAGGATGCGGCGGGTCCCCGGGAGGCTTTCCGGCAGCTGCGGGAGCTGTCCCGCCAGTGGCTGCGGCCTGACATCCGCACCAAGGAGCAGATCGTGGAGATGCTGGTGCAAGAGCAGCTGCTCGCCATCCTGCCCGAGGCGGCTCGGGCCCGGCGGATCCGCCGCCGCACGGATGTGCGCATCACTGGCTGA

Additionnal Information

SCAND1, RAZ1, SDP1, SCAND1, ATGD0161-10 µg, ATGD0161-20 µg, ATGD0161-50 µg, ATGD0161-100 µg, ATGD0161-250 µg, ATGD0161-500 µg, ATGD0161-1 mg, ATGD0161-10, ATGD0161-20, ATGD0161-50, ATGD0161-100, ATGD0161-250, ATGD0161-500, ATGD0161-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Epigenomics (Transcription & Translation)

Omim

610416

NCBI Accession Number

NP_057642.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_016558.3

DNA Size

540bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted Nde I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
More Discoveries

Explore Other Products

Browse additional items from our catalog

IDO1 (Indoleamine 2,3-dioxygenase 1, CD107B, IDO, INDO)
247381 50 µg

IDO1 (Indoleamine 2,3-dioxygenase 1, CD107B, IDO, INDO)

Sign In for Pricing
View Details
PE-Linked Monoclonal Antibody to Interleukin 10 (IL10)
MBS2149011-01 0.1 mL

PE-Linked Monoclonal Antibody to Interleukin 10 (IL10)

Sign In for Pricing
View Details
PE-Linked Monoclonal Antibody to Interleukin 10 (IL10)
MBS2149011-02 0.2 mL

PE-Linked Monoclonal Antibody to Interleukin 10 (IL10)

Sign In for Pricing
View Details
PE-Linked Monoclonal Antibody to Interleukin 10 (IL10)
MBS2149011-03 0.5 mL

PE-Linked Monoclonal Antibody to Interleukin 10 (IL10)

Sign In for Pricing
View Details
PE-Linked Monoclonal Antibody to Interleukin 10 (IL10)
MBS2149011-04 1 mL

PE-Linked Monoclonal Antibody to Interleukin 10 (IL10)

Sign In for Pricing
View Details
PE-Linked Monoclonal Antibody to Interleukin 10 (IL10)
MBS2149011-05 5 mL

PE-Linked Monoclonal Antibody to Interleukin 10 (IL10)

Sign In for Pricing
View Details