Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

NAA20 cDNA

NAT5 is a component of N-acetyltransferase complex B (NatB) . Human NatB performs cotranslational N (alpha) -terminal acetylation of methionine residues when they are followed by asparagine

Product Specifications

Product Name Alternative

DJ1002M8.1, NAT3, NAT3P, NAT5, NAT5P

Chromosomal Location

20p11.23

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGACCACGCTACGGGCCTTTACCTGCGACGACCTGTTCCGCTTCAACAACATTAACTTGGATCCACTTACAGAAACTTATGGGATTCCTTTCTACCTACAATACCTCGCCCACTGGCCAGAGTATTTCATTGTTGCAGAGGCACCTGGTGGAGAATTAATGGGTTATATTATGGGTAAAGCAGAAGGCTCAGTAGCTAGGGAAGAATGGCACGGGCACGTCACAGCTCTGTCTGTTGCCCCAGAATTTCGACGCCTTGGTTTGGCTGCTAAACTTATGGAGTTACTAGAGGAGATTTCAGAAAGAAAGGGTGGATTTTTTGTGGATCTCTTTGTAAGAGTATCTAACCAAGTTGCAGTTAACATGTACAAGCAGTTGGGCTACAGTGTATATAGGACGGTCATAGAGTACTATTCGGCCAGCAACGGGGAGCCTGATGAGGACGCTTATGATATGAGGAAAGCACTTTCCAGGGATACTGAGAAGAAATCCATCATACCATTACCTCATCCTGTGAGGCCTGAAGACATTGAATAA

Additionnal Information

NAA20, dJ1002M8.1, NAT3, NAT3P, NAT5, NAT5P, NAA20, ATGD0153-10 µg, ATGD0153-20 µg, ATGD0153-50 µg, ATGD0153-100 µg, ATGD0153-250 µg, ATGD0153-500 µg, ATGD0153-1 mg, ATGD0153-10, ATGD0153-20, ATGD0153-50, ATGD0153-100, ATGD0153-250, ATGD0153-500, ATGD0153-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Signal Transduction

Omim

610833

NCBI Accession Number

NP_057184.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_016100.4

DNA Size

540bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted Nde I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Ttc21b Mouse siRNA Oligo Duplex (Locus ID 73668)
SR422651 1 Kit

Ttc21b Mouse siRNA Oligo Duplex (Locus ID 73668)

Sign In for Pricing
View Details
Automatic Decapper, British Standard Plug
107002 1 pcs/cs

Automatic Decapper, British Standard Plug

Sign In for Pricing
View Details
ATP6V0E2 (NM_001100592) Human Tagged ORF Clone
RC224170 10 µg

ATP6V0E2 (NM_001100592) Human Tagged ORF Clone

Sign In for Pricing
View Details
Recombinant Mouse IFN-beta Protein (His-tag)
GB300051-M-100μg 100 μg

Recombinant Mouse IFN-beta Protein (His-tag)

Sign In for Pricing
View Details
pCMV-SPORT6-Aamp Plasmid
PVT55499 2 µg

pCMV-SPORT6-Aamp Plasmid

Sign In for Pricing
View Details
TPX2 Recombinant Rabbit mAb
orb2325894-01 25 µL

TPX2 Recombinant Rabbit mAb

Sign In for Pricing
View Details