Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

GNPNAT1 cDNA

GNPNAT1 (Glucosamine-Phosphate N-Acetyltransferase 1) is a Protein Coding gene. Among its related pathways are Biosynthesis of the N-glycan precursor (dolichol lipid-linked oligosaccharide, LLO) and transfer to a nascent protein and Biosynthesis of the N-glycan precursor (dolichol lipid-linked oligosaccharide, LLO) and transfer to a nascent protein.

Product Specifications

Product Name Alternative

GNPNAT, Gpnat1

Chromosomal Location

14q22.1

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGAAACCTGATGAAACTCCTATGTTTGACCCAAGTCTACTCAAAGAAGTGGACTGGAGTCAGAATACAGCTACATTTTCTCCAGCCATTTCCCCAACACATCCTGGAGAAGGCTTGGTTTTGAGGCCTCTTTGTACTGCTGACTTAAATAGAGGTTTTTTTAAGGTATTGGGTCAGCTAACAGAGACTGGAGTTGTCAGCCCTGAACAATTTATGAAATCTTTTGAGCATATGAAGAAATCTGGGGATTATTATGTTACAGTTGTAGAAGATGTGACTCTAGGACAGATTGTTGCTACGGCAACTCTGATTATAGAACATAAATTCATCCATTCCTGTGCTAAGAGAGGAAGAGTAGAAGATGTTGTTGTTAGTGATGAATGCAGAGGAAAGCAGCTTGGCAAATTGTTATTATCAACCCTTACTTTGCTAAGCAAGAAACTGAACTGTTACAAGATTACCCTTGAATGTCTACCACAAAATGTTGGTTTCTATAAAAAGTTTGGATATACTGTATCTGAAGAAAACTACATGTGTCGGAGGTTTCTAAAGTAA

Additionnal Information

GNPNAT1, GNPNAT, Gpnat1, GNPNAT1, ATGD0152-10 µg, ATGD0152-20 µg, ATGD0152-50 µg, ATGD0152-100 µg, ATGD0152-250 µg, ATGD0152-500 µg, ATGD0152-1 mg, ATGD0152-10, ATGD0152-20, ATGD0152-50, ATGD0152-100, ATGD0152-250, ATGD0152-500, ATGD0152-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Enzymes & Proteases

NCBI Accession Number

NP_932332.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_198066.3

DNA Size

555bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Cystatin 9 Like (CST9L) Antibody (Biotin)
abx310656-01 20 µg

Cystatin 9 Like (CST9L) Antibody (Biotin)

Sign In for Pricing
View Details
Cystatin 9 Like (CST9L) Antibody (Biotin)
abx310656-02 50 µg

Cystatin 9 Like (CST9L) Antibody (Biotin)

Sign In for Pricing
View Details
Cystatin 9 Like (CST9L) Antibody (Biotin)
abx310656-03 100 µg

Cystatin 9 Like (CST9L) Antibody (Biotin)

Sign In for Pricing
View Details
Cystatin 9 Like (CST9L) Antibody (Biotin)
abx310656-04 200 µg

Cystatin 9 Like (CST9L) Antibody (Biotin)

Sign In for Pricing
View Details
Cystatin 9 Like (CST9L) Antibody (Biotin)
abx310656-05 1 mg

Cystatin 9 Like (CST9L) Antibody (Biotin)

Sign In for Pricing
View Details
EFNA1 ELISA Kit (Mouse) (OKCA02378)
OKCA02378 96 Well

EFNA1 ELISA Kit (Mouse) (OKCA02378)

Sign In for Pricing
View Details