Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

RPA2 cDNA

As part of the heterotrimeric replication protein A complex (RPA/RP-A), binds and stabilizes single-stranded DNA intermediates, that form during DNA replication or upon DNA stress. It prevents their reannealing and in parallel, recruits and activates different proteins and complexes involved in DNA metabolism. Thereby, RPA2 plays an essential role both in DNA replication and the cellular response to DNA damage. In the cellular response to DNA damage, the RPA complex controls DNA repair and DNA damage checkpoint activation. Through recruitment of ATRIP activates the ATR kinase a master regulator of the DNA damage response. RPA2 is required for the recruitment of the DNA double-strand break repair factors RAD51 and RAD52 to chromatin in response to DNA damage. Also recruits to sites of DNA damage proteins like XPA and XPG that are involved in nucleotide excision repair and is required for this mechanism of DNA repair.

Product Specifications

Product Name Alternative

REPA2, RP-A p32, RP-A p34, RPA32

Chromosomal Location

1p35

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGTGGAACAGTGGATTCGAAAGCTATGGCAGCTCCTCATACGGGGGAGCCGGCGGCTACACGCAGTCCCCGGGGGGCTTTGGATCGCCCGCACCTTCTCAAGCCGAAAAGAAATCAAGAGCCCGAGCCCAGCACATTGTGCCCTGTACTATATCTCAGCTGCTTTCTGCCACTTTGGTTGATGAAGTGTTCAGAATTGGGAATGTTGAGATTTCACAGGTCACTATTGTGGGGATCATCAGACATGCAGAGAAGGCTCCAACCAACATTGTTTACAAAATAGATGACATGACAGCTGCACCCATGGACGTTCGCCAGTGGGTTGACACAGATGACACCAGCAGTGAAAACACTGTGGTTCCTCCAGAAACATATGTGAAAGTGGCAGGCCACCTGAGATCTTTTCAGAACAAAAAGAGCCTGGTAGCCTTTAAGATCATGCCCCTGGAGGATATGAATGAGTTCACCACACATATTCTGGAAGTGATCAATGCACACATGGTACTAAGCAAAGCCAACAGCCAGCCCTCAGCAGGGAGAGCACCTATCAGCAATCCAGGAATGAGTGAAGCAGGGAACTTTGGTGGGAATAGCTTCATGCCAGCAAATGGCCTCACTGTGGCCCAAAACCAGGTGTTGAATTTGATTAAGGCTTGTCCAAGACCTGAAGGGTTGAACTTTCAGGATCTCAAGAACCAGCTGAAACACATGTCTGTATCCTCAATCAAGCAAGCTGTGGATTTTCTGAGCAATGAGGGGCACATCTATTCTACTGTGGATGATGACCATTTTAAATCCACAGATGCAGAATAA

Additionnal Information

RPA2, REPA2, RP-A p32, RP-A p34, RPA32, RPA2, ATGD0142-10 µg, ATGD0142-20 µg, ATGD0142-50 µg, ATGD0142-100 µg, ATGD0142-250 µg, ATGD0142-500 µg, ATGD0142-1 mg, ATGD0142-10, ATGD0142-20, ATGD0142-50, ATGD0142-100, ATGD0142-250, ATGD0142-500, ATGD0142-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Epigenomics (Transcription & Translation)

Omim

179836

NCBI Accession Number

NP_002937.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_002946.4

DNA Size

813bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
Curated Selection

Explore Other Products

Discover premium biology products from our extensive collection of 20M+ items

PRSFDuet-1_VNp-mNeongreen-Erythropoietin Plasmid
PVT75607 2 µg

PRSFDuet-1_VNp-mNeongreen-Erythropoietin Plasmid

Ask
View Details
Human anti-Endomysial Antibody IgG, EMA IgG ELISA Kit
MBS9302010-01 48 Well

Human anti-Endomysial Antibody IgG, EMA IgG ELISA Kit

Ask
View Details
Human anti-Endomysial Antibody IgG, EMA IgG ELISA Kit
MBS9302010-02 96 Well

Human anti-Endomysial Antibody IgG, EMA IgG ELISA Kit

Ask
View Details
Human anti-Endomysial Antibody IgG, EMA IgG ELISA Kit
MBS9302010-03 5x 96 Well

Human anti-Endomysial Antibody IgG, EMA IgG ELISA Kit

Ask
View Details
Human anti-Endomysial Antibody IgG, EMA IgG ELISA Kit
MBS9302010-04 10x 96 Well

Human anti-Endomysial Antibody IgG, EMA IgG ELISA Kit

Ask
View Details
Rabbit Polyclonal JMJD2D Antibody [PE]
NBP1-03357PE 0.1 mL

Rabbit Polyclonal JMJD2D Antibody [PE]

Ask
View Details