Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

UBE2B cDNA

UBE2B (Ubiquitin-Conjugating Enzyme E2B) is a Protein Coding gene. Among its related pathways are TGF-Beta Pathway and Class I MHC mediated antigen processing and presentation. GO annotations related to this gene include ubiquitin-protein transferase activity and ubiquitin protein ligase binding. An important paralog of this gene is UBE2A

Product Specifications

Product Name Alternative

Ubiquitin-conjugating enzyme E2 B, E2 ubiquitin-conjugating enzyme B, RAD6 homolog B, RAD6B HR6B, hHR6B, Ubiquitin carrier protein B, Ubiquitin-conjugating enzyme E2-17 kDa, Ubiquitin-protein ligase B, Ubc2

Chromosomal Location

5q31.1

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGTCGACCCCGGCCCGGAGGAGGCTCATGCGGGATTTCAAGCGGTTACAAGAGGACCCACCTGTGGGTGTCAGTGGCGCACCATCTGAAAACAACATCATGCAGTGGAATGCAGTTATATTTGGACCAGAAGGGACACCTTTTGAAGATGGTACTTTTAAACTAGTAATAGAATTTTCTGAAGAATATCCAAATAAACCACCAACTGTTAGGTTTTTATCCAAAATGTTTCATCCAAATGTGTATGCTGATGGTAGCATATGTTTAGATATCCTTCAGAATCGATGGAGTCCAACATATGATGTATCTTCTATCTTAACATCAATTCAGTCTCTGCTGGATGAACCGAATCCTAACAGTCCAGCCAATAGCCAGGCAGCACAGCTTTATCAGGAAAACAAACGAGAATATGAGAAAAGAGTTTCGGCCATTGTTGAACAAAGCTGGAATGATTCATAA

Additionnal Information

E2 17 kDa, E2 17kDa, E2 ubiquitin conjugating enzyme B, E2 ubiquitin-conjugating enzyme B, E2-17kDa, HHR6B, HR6B, RAD6 homolog B, RAD6B, RAD6B HR6B, UBC2, UBE2B, Ubiquitin carrier protein B, Ubiquitin conjugating enzyme E2 17 kDa, Ubiquitin conjugating enzyme E2 17kDa, Ubiquitin conjugating enzyme E2 B, Ubiquitin conjugating enzyme E2B, Ubiquitin conjugating enzyme E2B hHR6B, Ubiquitin protein ligase B, Ubiquitin-conjugating enzyme E2 17 kDa, Ubiquitin-conjugating enzyme E2 17kDa, Ubiquitin-conjugating enzyme E2 B, Ubiquitin-conjugating enzyme E2-17 kDa, Ubiquitin-conjugating enzyme E2-17kDa, Ubiquitin-conjugating enzyme E2B, Ubiquitin-conjugating enzyme E2B hHR6B, Ubiquitin-protein ligase B, ATGD0138-10 µg, ATGD0138-20 µg, ATGD0138-50 µg, ATGD0138-100 µg, ATGD0138-250 µg, ATGD0138-500 µg, ATGD0138-1 mg, ATGD0138-010, ATGD0138-020, ATGD0138-050, ATGD0138-100, ATGD0138-250, ATGD0138-500, ATGD0138-01M

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Ubiquitination

Omim

179095

NCBI Accession Number

NP_003328.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_003337.3

DNA Size

459bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

BAT1P2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0170308 1.0 µg DNA

BAT1P2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

Sign In for Pricing
View Details
CEP57 siRNA (Human)
CRH6473-01 15 nmol

CEP57 siRNA (Human)

Sign In for Pricing
View Details
CEP57 siRNA (Human)
CRH6473-02 30 nmol

CEP57 siRNA (Human)

Sign In for Pricing
View Details
NEDD8 (H-2) AC
sc-373741 AC 500 µg/mL - 25% ag

NEDD8 (H-2) AC

Sign In for Pricing
View Details
P19skp1 (S-phase Kinase-associated Protein) (APC)
P1000-40H-APC 100 µL

P19skp1 (S-phase Kinase-associated Protein) (APC)

Sign In for Pricing
View Details
SETD2 Mouse Monoclonal Antibody [Clone ID: OTI1E1]
CF804377 100 µg

SETD2 Mouse Monoclonal Antibody [Clone ID: OTI1E1]

Sign In for Pricing
View Details