Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

HPGD cDNA

HPGD encodes a member of the short-chain nonmetalloenzyme alcohol dehydrogenase protein family. The encoded enzyme is responsible for the metabolism of prostaglandins, which function in a variety of physiologic and cellular processes such as inflammation. Mutations in this gene result in primary autosomal recessive hypertrophic osteoarthropathy and cranioosteoarthropathy. Multiple transcript variants encoding different isoforms have been found for this gene.

Product Specifications

Product Name Alternative

15-hydroxyprostaglandin dehydrogenase [NAD+], 15-PGDH, PGDH, PGDH1, SDR36C1, Prostaglandin dehydrogenase 1

Chromosomal Location

4q34-q35

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGCACGTGAACGGCAAAGTGGCGCTGGTGACCGGCGCGGCTCAGGGCATAGGCAGAGCCTTTGCAGAGGCGCTGCTGCTTAAGGGCGCCAAGGTAGCGCTGGTGGATTGGAATCTTGAAGCAGGTGTACAGTGTAAAGCTGCCCTGGATGAGCAGTTTGAACCTCAGAAGACTCTGTTCATCCAGTGCGATGTGGCTGACCAGCAACAACTGAGAGACACTTTTAGAAAAGTTGTAGACCACTTTGGAAGACTGGACATTTTGGTCAATAATGCTGGAGTGAATAATGAGAAAAACTGGGAAAAAACTCTGCAAATTAATTTGGTTTCTGTTATCAGTGGAACCTATCTTGGTTTGGATTACATGAGTAAGCAAAATGGAGGTGAAGGCGGCATCATTATCAATATGTCATCTTTAGCAGGACTCATGCCCGTTGCACAGCAGCCGGTTTATTGTGCTTCAAAGCATGGCATAGTTGGATTCACACGCTCAGCAGCGTTGGCTGCTAATCTTATGAACAGTGGTGTGAGACTGAATGCCATTTGTCCAGGCTTTGTTAACACAGCCATCCTTGAATCAATTGAAAAAGAAGAAAACATGGGACAATATATAGAATATAAGGATCATATCAAGGATATGATTAAATACTATGGAATTTTGGACCCACCATTGATTGCCAATGGATTGATAACACTCATTGAAGATGATGCTTTAAATGGTGCTATTATGAAGATCACAACTTCTAAGGGAATTCATTTTCAAGACTATGATACAACTCCATTTCAAGCAAAAACCCAATGA

Additionnal Information

15 Hydroxyprostaglandin dehydrogenase, 15 Hydroxyprostaglandin dehydrogenase [NAD (+) ], 15 hydroxyprostaglandin dehydrogenase [NAD+], 15 PGDH, 15-Hydroxyprostaglandin dehydrogenase, 15-Hydroxyprostaglandin dehydrogenase [NAD (+) ], 15-hydroxyprostaglandin dehydrogenase [NAD+], 15PGDH, 15-PGDH, AV026552, HPGD, PGDH, PGDH 1, PGDH1, PHOAR 1, PHOAR1, Prostaglandin dehydrogenase 1, Prostaglandin dehydrogenase1, SDR36C 1, SDR36C1, ATGD0137-10 µg, ATGD0137-20 µg, ATGD0137-50 µg, ATGD0137-100 µg, ATGD0137-250 µg, ATGD0137-500 µg, ATGD0137-1 mg, ATGD0137-010, ATGD0137-020, ATGD0137-050, ATGD0137-100, ATGD0137-250, ATGD0137-500, ATGD0137-01M

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Immunology

Omim

601688

NCBI Accession Number

NP_000851.2

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_000860

DNA Size

801bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Human OR5T2 Pre-designed siRNA Set A
SI011392A 1 Each

Human OR5T2 Pre-designed siRNA Set A

Sign In for Pricing
View Details
CD8B1, CT (CD8B, CD8B1, T-cell surface glycoprotein CD8 beta chain, CD8b) (APC)
MBS6283578-01 0.2 mL

CD8B1, CT (CD8B, CD8B1, T-cell surface glycoprotein CD8 beta chain, CD8b) (APC)

Sign In for Pricing
View Details
CD8B1, CT (CD8B, CD8B1, T-cell surface glycoprotein CD8 beta chain, CD8b) (APC)
MBS6283578-02 5x 0.2 mL

CD8B1, CT (CD8B, CD8B1, T-cell surface glycoprotein CD8 beta chain, CD8b) (APC)

Sign In for Pricing
View Details
Human 6-phosphofructokinase, Muscle Type (PFKM) ELISA Kit
MBS9714908-01 48 Tests

Human 6-phosphofructokinase, Muscle Type (PFKM) ELISA Kit

Sign In for Pricing
View Details
Human 6-phosphofructokinase, Muscle Type (PFKM) ELISA Kit
MBS9714908-02 96 Tests

Human 6-phosphofructokinase, Muscle Type (PFKM) ELISA Kit

Sign In for Pricing
View Details
Human 6-phosphofructokinase, Muscle Type (PFKM) ELISA Kit
MBS9714908-03 5x 96 Tests

Human 6-phosphofructokinase, Muscle Type (PFKM) ELISA Kit

Sign In for Pricing
View Details