Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

TAGLN cDNA

TAGLN encoded by this gene is a transformation and shape-change sensitive actin cross-linking/gelling protein found in fibroblasts and smooth muscle. Its expression is down-regulated in many cell lines, and this down-regulation may be an early and sensitive marker for the onset of transformation. A functional role of this protein is unclear. Two transcript variants encoding the same protein have been found for this gene

Product Specifications

Product Name Alternative

WS3-10, Transgelin, TAGLN1, Smooth muscle protein 22-alpha, SMCC, SM22 alpha, SM22

Chromosomal Location

11q23.2

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGGCCAACAAGGGTCCTTCCTATGGCATGAGCCGCGAAGTGCAGTCCAAAATCGAGAAGAAGTATGACGAGGAGCTGGAGGAGCGGCTGGTGGAGTGGATCATAGTGCAGTGTGGCCCTGATGTGGGCCGCCCAGACCGTGGGCGCTTGGGCTTCCAGGTCTGGCTGAAGAATGGCGTGATTCTGAGCAAGCTGGTGAACAGCCTGTACCCTGATGGCTCCAAGCCGGTGAAGGTGCCCGAGAACCCACCCTCCATGGTCTTCAAGCAGATGGAGCAGGTGGCTCAGTTCCTGAAGGCGGCTGAGGACTATGGGGTCATCAAGACTGACATGTTCCAGACTGTTGACCTCTTTGAAGGCAAAGACATGGCAGCAGTGCAGAGGACCCTGATGGCTTTGGGCAGCTTGGCAGTGACCAAGAATGATGGGCACTACCGTGGAGATCCCAACTGGTTTATGAAGAAAGCGCAGGAGCATAAGAGGGAATTCACAGAGAGCCAGCTGCAGGAGGGAAAGCATGTCATTGGCCTTCAGATGGGCAGCAACAGAGGGGCCTCCCAGGCCGGCATGACAGGCTACGGACGACCTCGGCAGATCATCAGTTAG

Additionnal Information

SM 22, SM22, SM22 alpha, SM22-alpha, SMCC, Smooth muscle protein 22 alpha, Smooth muscle protein 22-alpha, TAGLN, TAGLN 1, TAGLN1, TAGLN-1, Transgelin, WS3 10, WS310, WS3-10, ATGD0134-10 µg, ATGD0134-20 µg, ATGD0134-50 µg, ATGD0134-100 µg, ATGD0134-250 µg, ATGD0134-500 µg, ATGD0134-1 mg, ATGD0134-010, ATGD0134-020, ATGD0134-050, ATGD0134-100, ATGD0134-250, ATGD0134-500, ATGD0134-01M

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Cytoskeleton

Omim

600818

NCBI Accession Number

NP_001001522.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_001001522

DNA Size

606bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

FAM173B Rabbit pAb
E2507403 100 µL

FAM173B Rabbit pAb

Sign In for Pricing
View Details
Recombinant Caenorhabditis Elegans sip-1 Protein (aa 1-159)
VAng-Ly3685-50gEcoli 50 µg (E. coli)

Recombinant Caenorhabditis Elegans sip-1 Protein (aa 1-159)

Sign In for Pricing
View Details
CWF19L2 Lentiviral Vector (Mouse) (CMV) (pLenti-GIII-CMV)
17155064 1.0 µg DNA

CWF19L2 Lentiviral Vector (Mouse) (CMV) (pLenti-GIII-CMV)

Sign In for Pricing
View Details
Anti-NCCRP1 Monoclonal antibody (3A2)
MBS1567749-01 0.1 mg

Anti-NCCRP1 Monoclonal antibody (3A2)

Sign In for Pricing
View Details
Anti-NCCRP1 Monoclonal antibody (3A2)
MBS1567749-02 5x 0.1 mg

Anti-NCCRP1 Monoclonal antibody (3A2)

Sign In for Pricing
View Details
C7orf36 shRNA Plasmid (h)
sc-89365-SH 20 µg

C7orf36 shRNA Plasmid (h)

Sign In for Pricing
View Details