What is the catalog number for PSME1 cDNA?

The catalog number for PSME1 cDNA is ATGD0128-010.

What sizes are available for PSME1 cDNA?

PSME1 cDNA is available in the following size(s): 10 µg.

Is PSME1 cDNA in stock?

PSME1 cDNA is currently made to order / not held in immediate stock. Contact us for lead time.

PSME1 cDNA

The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. The immunoproteasome contains an alternate regulator, referred to as the 11S regulator or PA28, that replaces the 19S regulator. Three subunits (alpha, beta and gamma) of the 11S regulator have been identified. This gene encodes the alpha subunit of the 11S regulator, one of the two 11S subunits that is induced by gamma-interferon. Three alpha and three beta subunits combine to form a heterohexameric ring. Alternative splicing results in multiple transcript variants.

Product Specifications

Product Name Alternative

Proteasome activator subunit 1, 11S regulator complex subunit alpha, REG-alpha, Activator of multicatalytic protease subunit 1, Interferon gamma up-regulated I-5111 protein, IGUP I-5111, Proteasome activator 28 subunit alpha, PA28a, PA28alpha, IFI5111

Chromosomal Location

14q11.2

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGGCCATGCTCAGGGTCCAGCCCGAGGCCCAAGCCAAGGTGGATGTGTTTCGTGAAGACCTCTGTACCAAGACAGAGAACCTGCTCGGGAGCTATTTCCCCAAGAAGATTTCTGAGCTGGATGCATTTTTAAAGGAGCCAGCTCTCAATGAAGCCAACTTGAGCAATCTGAAGGCCCCATTGGACATCCCAGTGCCTGATCCAGTCAAGGAGAAAGAGAAAGAGGAGCGGAAGAAACAGCAGGAGAAGGAAGACAAGGATGAAAAGAAGAAGGGGGAGGATGAAGACAAAGGTCCTCCCTGTGGCCCAGTGAACTGCAATGAAAAGATCGTGGTCCTTCTGCAGCGCTTGAAGCCTGAGATCAAGGATGTCATTGAGCAGCTCAACCTGGTCACCACCTGGTTGCAGCTGCAGATACCTCGGATTGAGGATGGTAACAATTTTGGAGTGGCTGTCCAGGAGAAGGTGTTTGAGCTGATGACCAGCCTCCACACCAAGCTAGAAGGCTTCCACACTCAAATCTCTAAGTATTTCTCTGAGCGTGGTGATGCAGTGACTAAAGCAGCCAAGCAGCCCCATGTGGGTGATTATCGGCAGCTGGTGCACGAGCTGGATGAGGCAGAGTACCGGGACATCCGGCTGATGGTCATGGAGATCCGCAATGCTTATGCTGTGTTATATGACATCATCCTGAAGAACTTCGAGAAGCTCAAGAAGCCCAGGGGAGAAACAAAGGGAATGATCTATTGA

Additionnal Information

REG-alpha, REGalpha, PSME1, Proteasome activator subunit 1, Proteasome activator complex subunit 1, Proteasome activator 28 subunit alpha, PA28alpha, PA28a, PA28 Activator a Subunit, MGC8628, Interferon gamma up-regulated I-5111 protein, IGUP I-5111, IFI5111, Activator of multicatalytic protease subunit 1, 11S regulator complex subunit alpha, REG alpha, PA28 alpha, PA28 A, Interferon gamma up regulated I-5111 protein, Interferon gamma up regulated I5111 protein, ATGD0128-10 µg, ATGD0128-20 µg, ATGD0128-50 µg, ATGD0128-100 µg, ATGD0128-250 µg, ATGD0128-500 µg, ATGD0128-1 mg, ATGD0128-010, ATGD0128-020, ATGD0128-050, ATGD0128-100, ATGD0128-250, ATGD0128-500, ATGD0128-01M

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Ubiquitination

Omim

600654

NCBI Accession Number

NP_006254.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_006263.3

DNA Size

750bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.