Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

DNPH1 cDNA

DNPH1 was identified on the basis of its stimulation by c-Myc protein. The latter is a transcription factor that participates in the regulation of cell proliferation, differentiation, and apoptosis. The exact function of this gene is not known but studies in rat suggest a role in cellular proliferation and c-Myc-mediated transformation. Two alternative transcripts encoding different proteins have been described.

Product Specifications

Product Name Alternative

C6orf108, dJ330M21.3, RCL

Chromosomal Location

6p21.1

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGGCTGCTGCCATGGTGCCGGGGCGCAGCGAGAGCTGGGAGCGCGGGGAGCCTGGCCGCCCGGCCCTGTACTTCTGCGGGAGCATTCGCGGCGGACGCGAGGACAGGACGCTGTACGAGCGGATCGTGTCTCGGCTGCGGCGATTCGGGACAGTGCTCACCGAGCACGTGGCGGCCGCCGAGCTGGGCGCGCGCGGGGAAGAGGCTGCTGGGGGTGACAGGCTCATCCATGAGCAGGACCTGGAGTGGCTGCAGCAGGCGGACGTGGTCGTGGCAGAAGTGACACAGCCATCCTTGGGTGTAGGCTATGAGCTGGGCCGGGCCGTGGCCTTTAACAAGCGGATCCTGTGCCTGTTCCGCCCGCAGTCTGGCCGCGTGCTTTCGGCCATGATCCGGGGAGCAGCAGATGGCTCTCGGTTCCAGGTGTGGGACTATGAGGAGGGAGAGGTGGAGGCCCTGCTGGATCGATACTTCGAGGCTGATCCTCCAGGGCAGGTGGCTGCCTCCCCTGACCCAACCACTTGA

Additionnal Information

DNPH1, C6orf108, dJ330M21.3, RCL, DNPH1, ATGD0125-10 µg, ATGD0125-20 µg, ATGD0125-50 µg, ATGD0125-100 µg, ATGD0125-250 µg, ATGD0125-500 µg, ATGD0125-1 mg, ATGD0125-10, ATGD0125-20, ATGD0125-50, ATGD0125-100, ATGD0125-250, ATGD0125-500, ATGD0125-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Neuroscience

NCBI Accession Number

NP_006434.1

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_006443.2

DNA Size

525bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted Nde I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.

Frequently Asked Questions

More Discoveries

Explore Other Products

Browse additional items from our catalog

Chicken Fatty Acid Synthase (FASN) ELISA Kit
RD-FASN-Ch-01 96 Tests

Chicken Fatty Acid Synthase (FASN) ELISA Kit

Sign In for Pricing
View Details
Chicken Fatty Acid Synthase (FASN) ELISA Kit
RD-FASN-Ch-02 48 Tests

Chicken Fatty Acid Synthase (FASN) ELISA Kit

Sign In for Pricing
View Details
Adhesion G Protein-Coupled Receptor B2 (ADGRB2) Antibody
abx125494-01 20 µL

Adhesion G Protein-Coupled Receptor B2 (ADGRB2) Antibody

Sign In for Pricing
View Details
Adhesion G Protein-Coupled Receptor B2 (ADGRB2) Antibody
abx125494-02 50 µL

Adhesion G Protein-Coupled Receptor B2 (ADGRB2) Antibody

Sign In for Pricing
View Details
Adhesion G Protein-Coupled Receptor B2 (ADGRB2) Antibody
abx125494-03 100 µL

Adhesion G Protein-Coupled Receptor B2 (ADGRB2) Antibody

Sign In for Pricing
View Details
Adhesion G Protein-Coupled Receptor B2 (ADGRB2) Antibody
abx125494-04 200 µL

Adhesion G Protein-Coupled Receptor B2 (ADGRB2) Antibody

Sign In for Pricing
View Details