Welcome to GenPrice! Check out our latest updates.

Shopping Cart (0)

Your cart is empty

Add some products to get started!

NCBP2 cDNA

The product of NCBP2 is a component of the nuclear cap-binding protein complex (CBC), which binds to the monomethylated 5' cap of nascent pre-mRNA in the nucleoplasm. The encoded protein has an RNP domain commonly found in RNA binding proteins, and contains the cap-binding activity. The CBC promotes pre-mRNA splicing, 3'-end processing, RNA nuclear export, and nonsense-mediated mRNA decay. Multiple transcript variants encoding different isoforms have been found for this gene.

Product Specifications

Product Name Alternative

CBC2, CBP20, NIP1, PIG55

Chromosomal Location

3q29

Antigen Species

Human

Vector Type

PATGen (puc19-derived cloning vector)

Sequence

ATGTCGGGTGGCCTCCTGAAGGCGCTGCGCAGCGACTCCTACGTGGAGCTGAGCCAGTACCGGGACCAGCACTTCCGGGGTGACAATGAAGAACAAGAAAAATTACTGAAGAAAAGCTGTACGTTATATGTTGGAAATCTTTCTTTTTACACAACTGAAGAACAAATCTATGAACTCTTCAGCAAAAGTGGTGACATAAAGAAAATCATTATGGGTCTGGATAAAATGAAGAAAACAGCATGTGGATTCTGTTTTGTGGAATATTACTCACGCGCAGATGCGGAAAACGCCATGCGGTACATAAATGGGACGCGTCTGGATGACCGAATCATTCGCACAGACTGGGACGCAGGCTTTAAGGAGGGCAGGCAATACGGCCGTGGGCGATCTGGGGGCCAGGTTCGGGATGAGTATCGGCAGGACTACGATGCTGGGAGAGGAGGCTATGGAAAACTGGCACAGAACCAGTGA

Additionnal Information

NCBP2, CBC2, CBP20, NIP1, PIG55, NCBP2, ATGD0124-10 µg, ATGD0124-20 µg, ATGD0124-50 µg, ATGD0124-100 µg, ATGD0124-250 µg, ATGD0124-500 µg, ATGD0124-1 mg, ATGD0124-10, ATGD0124-20, ATGD0124-50, ATGD0124-100, ATGD0124-250, ATGD0124-500, ATGD0124-1

Storage Conditions

Store the plasmid at -20C.

Formulation

Lyophilized

Scientific Category

Epigenomics (Transcription & Translation)

Omim

65133

NCBI Accession Number

NP_031388.2

Species

Human

Preparation

1. Centrifuge at 7000rpm for 1 minute.; ;2. Carefully open the vial and add 100 µL of sterile water to dissolve the DNA.; ; Each tube contains approximately 10 µg of lyophilized plasmid.

RNA Reference

NM_007362.3

DNA Size

471bp

Vector Description

This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
More Discoveries

Explore Other Products

Browse additional items from our catalog

TMEM87B sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
47102111 3x 1.0 µg

TMEM87B sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

Sign In for Pricing
View Details
Pbx3 Mouse Pre-designed siRNA Set A
HY-RS22270 1 Set

Pbx3 Mouse Pre-designed siRNA Set A

Sign In for Pricing
View Details
Fpr1 3'UTR GFP Stable Cell Line
TU254774 1.0 mL

Fpr1 3'UTR GFP Stable Cell Line

Sign In for Pricing
View Details
TRAIL (TNF-Related Apoptosis Inducing Ligand, Apo2L, TL2, TNFSF10) (HRP) discontinued
T8180-05-HRP 100 µL

TRAIL (TNF-Related Apoptosis Inducing Ligand, Apo2L, TL2, TNFSF10) (HRP) discontinued

Sign In for Pricing
View Details
Ceritinib Impurity 34
RM-C051834-01 10 mg

Ceritinib Impurity 34

Sign In for Pricing
View Details
Ceritinib Impurity 34
RM-C051834-02 25 mg

Ceritinib Impurity 34

Sign In for Pricing
View Details